to examine options for alignment innovation and
play

To examine options for alignment, innovation and development of - PowerPoint PPT Presentation

Apr 18, 2023 •370 likes •433 views

Set up under and reports to the UKPHR Education & Training Committee Chaired by Professor Susan Powell of Manchester Metropolitan University To examine options for alignment, innovation and development of UKPHRs standards,

  2.  Set up under and reports to the UKPHR Education & Training Committee  Chaired by Professor Susan Powell of Manchester Metropolitan University To examine options for alignment, innovation and development of UKPHR’s standards, practices and processes with developments in relation to public health practitioners since the current arrangements were settled

  3. 5 Years on…. HEE’s “deep dive” study into practitioner registration UKPHR revalidation scheme for all registrants

  4. Summer 2017 Recommendations External Revision of to UKPHR Board for Potential contractor sought Consultation approval proposals in implementation of to produce on its new standards, - May undertake evidence- light of practices and proposals further stakeholder informed processes consultation and wider recommendations consultation

  5. Workshops In this room Room in the front right Opportunity to feedback Exchange of good practice into the work of UKPHR’s and ideas with assessors practitioner T&F group and verifiers

Recommend

Innovation Program University Council Discussion November 18, 2014 Academic Alignment &

Innovation Program University Council Discussion November 18, 2014 Academic Alignment &

Academic Alignment and Innovation Program University Council Discussion November 18, 2014 Academic Alignment & Innovation Program Ensure that the liberal arts are central to todays higher education Communicate the outcomes of the

200 views • 6 slides
Registration Todays Program: Options in the HS HS Credits Alignment of the

Registration Todays Program: Options in the HS HS Credits Alignment of the

Eighth Grade Course Registration Todays Program: Options in the HS HS Credits Alignment of the curriculum Arabic & Islamic Education Sample schedules Universities Q & A Handout of course registration

433 views • 21 slides
Primary Cares Initiative Overview of Direct Contracting: Global PBP and Professional PBP Options

Primary Cares Initiative Overview of Direct Contracting: Global PBP and Professional PBP Options

Primary Cares Initiative Overview of Direct Contracting: Global PBP and Professional PBP Options INFORMATIONAL WEBINAR Agenda CMS Innovation Center Background Goals and Design Participation Opportunities Beneficiary Alignment

1k views • 42 slides
Article VIII, Section 22 Spending Limit Examine options and make recommendations for

Article VIII, Section 22 Spending Limit Examine options and make recommendations for

Article VIII, Section 22 Spending Limit Examine options and make recommendations for strengthening restrictions on appropriations established in Article VIII, Section 22, of the Texas Constitution, including related procedures defined in

556 views • 9 slides
Integrity Urgency Ownership Alignment Innovation Hilcorp

Integrity Urgency Ownership Alignment Innovation Hilcorp

Integrity Urgency Ownership Alignment Innovation Hilcorp Alaska 500+ Full-Time Employees ~90% Alaska Resident Hire $5 Billion+ Investments in Alaska North Slope Production ~50,000 BOPD

475 views • 10 slides
Sequence Alignment (chapter 6) The biological problem l Global alignment l Local alignment l

Sequence Alignment (chapter 6) The biological problem l Global alignment l Local alignment l

Sequence Alignment (chapter 6) The biological problem l Global alignment l Local alignment l Multiple alignment l Introduction to bioinformatics, Autumn 2006 22 Background: comparative genomics Basic question in biology: what properties

934 views • 44 slides
What is text alignment? Text alignment is the comparison of two or more parallel texts It

What is text alignment? Text alignment is the comparison of two or more parallel texts It

A tool for syntax-based intra-language text alignment Tariq Yousef, Chiara Palladino University of Leipzig Berlin Digital Classicist Seminars, November 29, 2016 What is text alignment? Text alignment is the comparison of two or more

688 views • 53 slides
Where to look? Examine the national water plan (2008-2011). Examine the plans

Where to look? Examine the national water plan (2008-2011). Examine the plans

Where to look? Examine the national water plan (2008-2011). Examine the plans implementation. Examine the status of the right to water in a rural community that manages its own water. What to see? Core human rights principles

313 views • 4 slides
Sequence Alignment (chapter 6) p The biological problem p Global alignment p Local alignment p

Sequence Alignment (chapter 6) p The biological problem p Global alignment p Local alignment p

Sequence Alignment (chapter 6) p The biological problem p Global alignment p Local alignment p Multiple alignment 200 Local alignment: rationale p Otherwise dissimilar proteins may have local regions of similarity -> Proteins may share a

980 views • 56 slides
TOD Alignment Rezoning Public Meeting July 18, 2019 TOD Alignment Rezoning The TOD Alignment

TOD Alignment Rezoning Public Meeting July 18, 2019 TOD Alignment Rezoning The TOD Alignment

TOD Alignment Rezoning Public Meeting July 18, 2019 TOD Alignment Rezoning The TOD Alignment Rezoning initiative is the implementation tool for the four new Transit Oriented Development (TOD) zoning districts. Parcels in station areas along

257 views • 14 slides
State Innovation Waiver Policy Forum: Preliminary Policy Options for Further Consideration AUDREY

State Innovation Waiver Policy Forum: Preliminary Policy Options for Further Consideration AUDREY

State Innovation Waiver Policy Forum: Preliminary Policy Options for Further Consideration AUDREY MORSE GASTEIER Director of Policy and Outreach EMILY BRICE Senior Policy Advisor on State Innovation Waivers November 25, 2015 Goals for

475 views • 25 slides
THE GDB DEBUGGER GDB Debuggers allow you to examine and control program execution To compile a

THE GDB DEBUGGER GDB Debuggers allow you to examine and control program execution To compile a

THE GDB DEBUGGER GDB Debuggers allow you to examine and control program execution To compile a program for use with gdb, use the -g compiler switch Most debuggers provide the same functionality Other graphical options on MCECS Linux

506 views • 8 slides
Ben Burr Trail PROJECT ALIGNMENT Project alignment Hamblen Elem School PROJECT ALIGNMENT

Ben Burr Trail PROJECT ALIGNMENT Project alignment Hamblen Elem School PROJECT ALIGNMENT

Ben Burr Trail PROJECT ALIGNMENT Project alignment Hamblen Elem School PROJECT ALIGNMENT New alignment Existing Hamblen gravel Elem School trail PUBLIC PRESENTATIONS Initial presentation to adjacent property owners in late

505 views • 24 slides
Innovation Strategy & Guidelines 26/09/19 Innovation in TII What is Innovation? Innovation

Innovation Strategy & Guidelines 26/09/19 Innovation in TII What is Innovation? Innovation

Innovation Strategy & Guidelines 26/09/19 Innovation in TII What is Innovation? Innovation is the process of creating value by applying novel solutions to meaningful problems. Public Sector Innovation Drivers of Innovation PS2020

643 views • 20 slides
CSE 427 Comp Bio Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming

CSE 427 Comp Bio Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming

CSE 427 Comp Bio Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming Algorithm 2 Sequence Alignment Goal: position characters in two strings to best line up identical/similar ones with one another We can do this

941 views • 56 slides
CSE 421 Algorithms Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming

CSE 421 Algorithms Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming

CSE 421 Algorithms Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming Algorithm 2 Sequence Alignment Goal: position characters in two strings to best line up identical/similar ones with one another We can do

473 views • 28 slides
Sequence Alignment Sequence Alignment AGGCTATCACCTGACCTCCAGGCCGATGCCC

Sequence Alignment Sequence Alignment AGGCTATCACCTGACCTCCAGGCCGATGCCC

Sequence Alignment Sequence Alignment AGGCTATCACCTGACCTCCAGGCCGATGCCC TAGCTATCACGACCGCGGTCGATTTGCCCGAC -AGGCTATCACCTGACCTCCAGGCCGA--TGCCC--- || ||||||| |||| | || ||| ||||| TAG-CTATCAC--GACCGC--GGTCGATTTGCCCGAC Distance from sequences

767 views • 62 slides
Ben Burr Trail PROJECT ALIGNMENT Project alignment Hamblen Elem School PROJECT ALIGNMENT

Ben Burr Trail PROJECT ALIGNMENT Project alignment Hamblen Elem School PROJECT ALIGNMENT

Ben Burr Trail PROJECT ALIGNMENT Project alignment Hamblen Elem School PROJECT ALIGNMENT New alignment Existing Hamblen gravel Elem School trail COMPREHENSIVE PLAN Spokane features three major transportation pathways or

696 views • 25 slides
Canadian Culture Bow Valley College Objectives To examine the meaning of culture To

Canadian Culture Bow Valley College Objectives To examine the meaning of culture To

Canadian Culture Bow Valley College Objectives To examine the meaning of culture To examine intercultural awareness and competencies To examine the kinds of learning that are suited to teaching culture To create a task that helps

371 views • 12 slides
This week CSE 527 Sequence alignment Computational Biology More sequence alignment

This week CSE 527 Sequence alignment Computational Biology More sequence alignment

This week CSE 527 Sequence alignment Computational Biology More sequence alignment Autumn 2007 Weekly bio interlude - DNA replication Lectures 2-3 Sequence Alignment; DNA Replication 1 Sequence Alignment What Why

492 views • 15 slides
New Member Orientation Workforce Innovation and Opportunity Act W I O A Goal : Tostrengthen

New Member Orientation Workforce Innovation and Opportunity Act W I O A Goal : Tostrengthen

New Member Orientation Workforce Innovation and Opportunity Act W I O A Goal : Tostrengthen the U.S. workforce development system through innovation in, and alignment and improvement of, employment, training, and education programs

786 views • 45 slides
Department & Division of Forestry Alignment Proposals February 2016 Alignment Goals 1.

Department & Division of Forestry Alignment Proposals February 2016 Alignment Goals 1.

Department & Division of Forestry Alignment Proposals February 2016 Alignment Goals 1. Mission, Vision, Values, and One DNR approach. 2. Increase alignment. 3. Improved workload management. 4. Increase efficiency. 5. Improve

636 views • 34 slides
Playing Field New Site Options Park Board Committee Meeting October 2, 2017 Index 1.

Playing Field New Site Options Park Board Committee Meeting October 2, 2017 Index 1.

Synthetic Turf Playing Field New Site Options Park Board Committee Meeting October 2, 2017 Index 1. Recommendation 6. Current Options: a. Beaconsfield Park 2. Background: Strategic Alignment b. Clinton Park c. Sir Winston Churchill

672 views • 28 slides
Alignment in C Seminar Effiziente Programmierung in C Sven-Hendrik Haase Universit at

Alignment in C Seminar Effiziente Programmierung in C Sven-Hendrik Haase Universit at

Introduction Data Structure Alignment Heap Alignment Stack Alignment Summary Alignment in C Seminar Effiziente Programmierung in C Sven-Hendrik Haase Universit at Hamburg, Fakult at f ur Informatik 2014-01-09 Sven-Hendrik

847 views • 84 slides

More recommend