Introduction : DNA and microarrays Two- and Three-state models Analysis of experimental data Nonequilibrium effects in DNA microarrays: a multiplatform study Jean-Charles Walter KU Leuven, Belgium Collaborators : Myriam Kroll , Jef Hooyberghs and Enrico Carlon LAFNES11, Dresden July 14 DNA Microarrays
Introduction : DNA and microarrays Two- and Three-state models Analysis of experimental data Outline Introduction : DNA and microarrays 1 Two- and Three-state models 2 Analysis of experimental data 3 DNA Microarrays
Introduction : DNA and microarrays Two- and Three-state models Analysis of experimental data DNA double helix DNA Microarrays
Introduction : DNA and microarrays Two- and Three-state models Analysis of experimental data Information in the cell replication transcription translation DNA Proteine RNA 3' 5' Antisense strand RNA polymerase C T G AC G G AT C A GC C G C A A G GG C A A TT GG G C A C A T A A G C A U G C C U A GU C G G C G U U 3' 5' mRNA Transcript 5' 3' G A C G T C C T A G T C G G C G TT C G C C TT AA C C G C T G T A TT Sense Strand DNA Microarrays
Introduction : DNA and microarrays Two- and Three-state models Analysis of experimental data DNA microarrays : principle Strands on the surface : probes Strands labelled in solution : targets Gene expression, detection of mutations... DNA Microarrays
Introduction : DNA and microarrays Two- and Three-state models Analysis of experimental data Two-state model d θ dt = ck 1 ( 1 − θ ) − k − 1 θ k 1 / k − 1 = e − ∆ G / RT DNA Microarrays
Introduction : DNA and microarrays Two- and Three-state models Analysis of experimental data Two-state model ce − ∆ G / RT c , − ∆ G ≪ 1 ce − ∆ G / RT θ eq = ≈ 1 + ce − ∆ G / RT θ ( t ) = θ eq ( 1 − e − t /τ ) ( θ ( 0 ) = 0 ) � k 1 = Cst = α k − 1 = α · e ∆ G / RT 1 1 τ = = ck 1 + k − 1 α ( c + e ∆ G / RT ) DNA Microarrays
Introduction : DNA and microarrays Two- and Three-state models Analysis of experimental data Two-state model chemical saturation 0 10 Langmuir isotherm t=86h -2 10 t=17h t=4h θ -4 10 dynamical saturation ~1/RT -6 10 -8 10 5 10 15 20 25 30 35 40 - ∆ G (kcal/mol) T = 337K, c = 5 pM and k 1 = 10 4 s − 1 M − 1 . DNA Microarrays
Introduction : DNA and microarrays Two- and Three-state models Analysis of experimental data Three-state model k −1 k 1 θ 1 θ 2 k −2 = γ k ∆ ∆ 2 ∆ ’ G G G Hooyberghs, Baiesi, Ferrantini and Carlon (PRE, 2010) JCW, Kroll, Hooyberghs and Carlon (J.Phys.Chem.B, 2011) DNA Microarrays
Introduction : DNA and microarrays Two- and Three-state models Analysis of experimental data Three-state model d θ 1 dt = ck 1 ( 1 − θ 1 − θ 2 ) + k − 2 θ 2 − ( k − 1 + k 2 ) θ 1 , d θ 2 dt = k 2 θ 1 − k − 2 θ 2 , k 1 / k − 1 = e − ∆ G ′ / RT k 2 / k − 2 = e − (∆ G − ∆ G ′ ) / RT , k − 1 = α e ∆ G ′ / RT , k 1 = α ; k − 2 = ω e (∆ G − ∆ G ′ ) / RT . k 2 = ω ; DNA Microarrays
Introduction : DNA and microarrays Two- and Three-state models Analysis of experimental data Three-state model chemical saturation 0 10 intermediate t=86h regime t=17h ~1/RT eff -2 t=4h 10 θ -4 dynamical saturation 10 -6 10 Langmuir isotherm ~ 1/RT exp -8 10 5 10 15 20 25 30 35 40 - ∆ G (kcal/mol) T = 337K, c = 5 pM , k 1 = 10 5 s − 1 M − 1 , k 2 = 1 s − 1 and γ = 1 / 3. DNA Microarrays
Introduction : DNA and microarrays Two- and Three-state models Analysis of experimental data Agilent microarrays (c) (d) (b) (a) DNA Microarrays
Introduction : DNA and microarrays Two- and Three-state models Analysis of experimental data Agilent microarrays Design : 1 single Target : 3’ ATTCGCCTATTGGACTACGTATTGCTCAGC 5’ Perfect Match Probe : 5’ TAAGCGGATAACCTGATGCATAACGAGTCG 3’ One Mismatch Probes : 5’ TAACCGGATAACCTGATGCATAACGAGTCG 3’ Two Mismatches Probes : 5’ TAAGCTGATAACCTGATGCATCACGAGTCG 3’ DNA Microarrays
Introduction : DNA and microarrays Two- and Three-state models Analysis of experimental data Agilent microarrays 6 10 L=30 nt, 50 pM, 65°C, 17h 4 10 I 2 10 t L (a) 0 10 -8 -6 -4 -2 0 - ∆∆ G µ array (kcal/mol) 6 6 10 10 L=30 nt, 50 pM, 65°C, 86h L=25 nt, 500 pM, 65°C, 17h 4 4 10 10 I I 2 2 10 10 (b) (c) 0 0 10 10 -8 -6 -4 -2 0 -8 -6 -4 -2 0 - ∆∆ G µ array (kcal/mol) - ∆∆ G µ array (kcal/mol) Fit : k 1 = 5 · 10 3 s − 1 M − 1 , k 2 = 1 s − 1 and γ = 1 / 3. DNA Microarrays
Introduction : DNA and microarrays Two- and Three-state models Analysis of experimental data Affymetrix microarrays Data from Suzuki et al (BMC Genomics, 2007) Design : 150 � = Targets ( L = 25 nt ) : 3’ ATTCGCCTATTGGACTACGTATTGCTCAGC 5’ Probes with varying length : Perfect Match : 5’ TAAGCGGATAACCTGATGCATAACGAGTCG 3’ ( L = 25 nt ) 5’ AAGCGGATAACCTGATGCATAACGAGTCG 3’ ( L = 24 nt ) · · · 5’ TGCATAACGAGTCG 3’( L = 14 nt ) One Mismatch : 5’ TAAGCGGATAACCTGATGCATAACGAGTCG 3’ ( L = 25 nt ) 5’ AAGCGGATAACCTGATGCATAACGAGTCG 3’ ( L = 24 nt ) · · · 5’ CCTGATGCATAACGAGTCG 3’ ( L = 14 nt ) DNA Microarrays
Introduction : DNA and microarrays Two- and Three-state models Analysis of experimental data Affymetrix microarrays ~1/RT eff 5 10 ~1/RT exp 1.4fM 14fM 140fM 1.4pM 14pM 140pM 1.4nM 3 I 10 10 15 20 25 30 - ∆ G (kcal/mol) t = 16 h , T exp = 318K, T eff = 850K = 2 . 7 T exp DNA Microarrays
Introduction : DNA and microarrays Two- and Three-state models Analysis of experimental data Affymetrix microarrays 5 10 14fM 140fM 1.4pM 3 I 10 10 10 15 20 25 30 35 - ∆ G (kcal/mol) k 1 = 10 5 s − 1 M − 1 , k 2 = 1 s − 1 and γ = 0 . 374 DNA Microarrays
Introduction : DNA and microarrays Two- and Three-state models Analysis of experimental data Conclusion Thermodynamics of DNA µ array still poorly understood. Discrepancy between experiments and the two-state model : nonequilibrium effects. Weaker slope : effective temperature. Saturation of the signal at a lower value : dynamical saturation. Consequences on the behavior of the devices. DNA Microarrays
Introduction : DNA and microarrays Two- and Three-state models Analysis of experimental data Agilent microarrays 6 10 c=250pM L=30, 65°C, 17h c=50pM 4 10 c=10pM I c=2pM 2 10 0 10 -8 -6 -4 -2 0 - ∆∆ G µ array (kcal/mol) Intensity proportional to the concentration : far from saturation. DNA Microarrays
Introduction : DNA and microarrays Two- and Three-state models Analysis of experimental data Agilent microarrays 6 10 c=5000pM L=30, T=55°C, 17h equilibrium region c=500pM 4 T 10 c=50pM I 2 10 non-equilibrium region 0 10 14 16 18 20 22 24 26 28 30 - ∆ G sol (kcal/mol) DNA Microarrays
Introduction : DNA and microarrays Two- and Three-state models Analysis of experimental data DNA double helix Estimation of the Gibbs free energy : ∆ G = ∆ H − T ∆ S with the nearest-neighbor model : � T A C � T A � A C � � � ∆ G = ∆ G + ∆ G , A T G A T T G where the values are estimated in solution. DNA Microarrays
Introduction : DNA and microarrays Two- and Three-state models Analysis of experimental data Affymetrix microarrays 0 10 -2 10 -4 10 -6 5 pM θ 10 5.10 3 pM 5.10 -8 10 1 pM 5.10 -10 -1 pM 5.10 10 -3 pM 5.10 -12 10 -14 10 0 10 20 30 40 - ∆ G (kcal/mol) T = 337K, t = 17 h , k 1 = 10 5 s − 1 M − 1 , k 2 = 1 s − 1 and γ = 1 / 3. DNA Microarrays
Recommend
More recommend
