Metagenomic analysis of spoiled potato and tomato and the use of the - PowerPoint PPT Presentation

Metagenomic analysis of spoiled potato and tomato and the use of the dominant bacterial species in plant growth studies Khaya Ntushelo Department of Agriculture and Animal Health, University of South Africa, Science Campus, Florida, 1710, South Africa

Unisa Science Campus Research • Metagenomics • Plant-microbe interactions • Potato diseases

Metagenomics: Introduction • Metagenome – Handelsman 1988 – University of Wisconsin–Madison • As applicable to bacteria • Popular – gut, soil, extreme environments, ocean water, sewage • Direct study of genetic material from environmental samples • Prominence with high-throughput genomic sequencing

Known metagenomics projects • Sargasso Sea and Global Ocean Survey Metagenomics – genetic diversity in marine microbial communities • Human Microbiome Project

Rationale for our study

Introduction: Bacterial metagenomics of potato and tomato Polokwane Hoedspruit Laphalale Ladanna Skeerpoort Vryburg Bothaville Warden Petrusburg

Metagenomics: Sample preparation

PCR products of the 16S rRNA gene run through agarose gel pAF:AGAGTTTGATCCTGGCTCAG/ pHR:AAGGAGGTGATCCAGCCGCA Edwards et al., 1989

Analysis of the 16S rRNA gene pAF:AGAGTTTGATCCTGGCTCAG/pHR:AAGGAGGTGATCCAGCCGCA Edwards et al., amplified ~ 550 bp of the 16S region targeting the v3-v4 region with Illumina MiSeq 300 x 300 pair-end reads

MALDI-TOF

MALDI-TOF compared with sequence analysis of the 16S rRNA gene GeneBank Identification by sequence analysis of Accession Sample code Source Locality Identification by MALDI-TOF Comment on mismatch identification the 16S rRNA gene number KP823022 Unisa1 a Potato Bothaville Myroides odoratimimus Myroides odoratimimus KP823024 Unisa2 a Potato Bothaville Myroides odoratimimus Myroides odoratimimus KP823030 Unisa3 a Potato Bothaville Myroides odoratimimus Myroides odoratimimus KP823036 Unisa4 a Potato Bothaville Myroides odoratimimus Myroides odoratimimus KP823029 Unisa5 b Potato Bothaville Myroides odoratimimus Myroides odoratimimus

Results of the 16S rRNA gene-based metagenomics Comment Organism/Hit name Cluster size Result count Acinetobacter sp. 1 1 Non bacterial hit Acricotopus lucens 1 1 Non bacterial hit Alicyclobacillus acidoterrestris 1 1 Spoilage bacterium Allenhyphes flinti 1 1 Canine pathogen Anaplasma platys 1 1 Non bacterial hit Antheraea pernyi 1 1 Non bacterial hit Aphidius ervi 1 1 Non bacterial hit Asterias forbesii 1 1 Bacillus halodurans 18 1 Bacillus licheniformis 11 2 Bacillus sp. 9 3 Bacillus subtilis 3336 4 Non bacterial hit Clastoptera testacea 1 1 Non bacterial hit Danaus affinis 1 1 Geobacillus thermoleovorans 279 2 Enterobacter sp. 7377 5 Non bacterial hit Eucalyptus tereticornis 1 1 Non bacterial hit Fusarium equiseti 1 1 Non bacterial hit Fusarium oxysporum 1 1 Non bacterial hit Galleria mellonella 4 3 Geobacillus sp. 69 3 Geobacillus stearothermophilus 566 2 Myroides sp. 3 1 Non bacterial hit Nicotiana tabacum 18 3

Results of the 16S rRNA gene-based metagenomics: Summary Dominant genera • Bacillus • Geobacillus • Enterobacter

Bacillus and plants • Growth promoter • Control of pathogens • Effect on germination and on potato growth scanty • Bacillus – an antagonist of the blackleg pathogen Pbcb • New tools, and a variety of combined treatments

Bacillus and plants Seed germination AND seedling vigour experiment • Okra • Seed coated with Bacillus subtilis • 5 x 3 x 2 factorial experiment (rep 5x in 3 cycles) – Aluminium toxicity, temperature and B & No B – In total 450 Petri plates were examined in the data collection, 50 plates for the chemical analysis

Seed germination assays Germination percentage, Coleoptile length Chemistries of the germination medium and the germinated seed Cations quantified in the 50 samples K mg/kg P mg/kg Mg mg/kg Ca mg/kg Na mg/kg Al mg/kg Fe mg/kg Zn mg/kg Mn mg/kg B mg/kg Cu mg/kg Avearage (Bacillus) 8467.400 5703.200 3414.280 1425.776 769.064 3143.028 70.020 60.210 18.560 21.134 11.455 Avearage (No Bacillus) 8196.120 5628.800 3355.040 1437.152 604.252 3308.372 65.164 59.859 18.580 20.960 11.247 Anions quantified in the 50 samples PO 4 3- mg/kg Fl - mg/kg Cl - mg/kg SO 4 2- mg/kg NO 3 - mg/kg NO 2 - mg/kg Avearage (Bacillus) 3358.940 968.550 2166.400 643.780 131.400 40.360 Avearage (No Bacillus) 4172.370 606.200 2106.870 629.290 169.830 16.600 Secondary metabolite shifts in the germinated seed

Seed germination assays Germination percentage, Coleoptile length Chemistries of the germination medium and the germinated seed Cations quantified in the 50 samples K mg/kg P mg/kg Mg mg/kg Ca mg/kg Na mg/kg Al mg/kg Fe mg/kg Zn mg/kg Mn mg/kg B mg/kg Cu mg/kg Avearage (Bacillus) 8467.400 5703.200 3414.280 1425.776 769.064 3143.028 70.020 60.210 18.560 21.134 11.455 Avearage (No Bacillus) 8196.120 5628.800 3355.040 1437.152 604.252 3308.372 65.164 59.859 18.580 20.960 11.247 Anions quantified in the 50 samples 3- mg/kg Fl - mg/kg Cl - mg/kg 2- mg/kg - mg/kg - mg/kg PO 4 SO 4 NO 3 NO 2 Avearage (Bacillus) 3358.940 968.550 2166.400 643.780 131.400 40.360 Avearage (No Bacillus) 4172.370 606.200 2106.870 629.290 169.830 16.600 No differences in the ionic composition of Bacillus-treated and Bacillus-untreated samples: conclusion

Effect of Bacillus on the germination on okra

Effect of Bacillus on the germination on okra

Secondary metabolite shifts due to Bacillus treatment

Secondary metabolite shifts due to Bacillus treatment Data output was NMR intensity values Phase correction and baseline correction of the NMR spectra were done using ACD/NMR Processor. NMR intensities were selected from the range zero to 14 ppm. PCA was done using Multibase 2014

Bacillus and plants Potato growth, yield and disease suppression studies

Data collected in the plant growth studies • Growth parameters • Stomatal conductance • Chlorophyll content • Chemical analysis • Will extend to a whole range of molecular data

Effect of Bacillus on the growth of potato

Effect of Bacillus on the growth of potato

Preliminary findings • A few bacterial species dominate potato and tomato • Sequence analysis of the 16S rRNA gene and MALDI-TOF give the same result of bacterial species IDs • Bacillus – one of the dominant species promotes germination of okra growth of potato • Not much bacterial cells are needed to cause germination and growth effects • Bacillus ineffective in high temperature • A small portion of the okra germinating seed chemistry is altered to boost germination

Still to come • Tuber yield data • Bacterial antagonism • Molecular interactions between Bacillus and bacterial plant pathogens

Acknowledgements • Postdoctoral researcher – Sheku Kanu • MSc student – Taboga Mathiba • BTech students –Livhuwani Nemutandani and Mpho Nematswerani • PPRI for providing the Bacillus strains used • Inqaba Biotech and the ARC Biotechnology Platform for their facilities and expertise shared • University of Pretoria for MALDI-TOF • Unisa for funding