Information and Information Processing in Biological Systems Peter Schuster, Eörs Szathmáry, and Avshalom Elitzur Institut für Theoretische Chemie, Universität Wien, Austria, Collegium Budapest – Institute for Advanced Study , Ungarn, and Bar-Ilan University, Israel Europäisches Forum Alpbach Alpbach, 18.– 25.08.2005
Web-Pages for further information: http://www.tbi.univie.ac.at/~pks http://www.colbud.hu/fellows/szathmary.shtml http://faculty.biu.ac.il/~elitzua/
Program Friday, Aug.19: 9:00-9:30 Peter Schuster, Evolution and Information 9:30-10:15 Avshalom Elitzur, Information, Complexity and the Physics of Life 10:15-10:30 Coffee Break 10:30-11:30 Avshalom Elitzur, Information, Complexity and the Physics of Life 11:30-12:00 Discussion Saturday, Aug.20: 9:00-10:00 Eörs Szathmáry, Genetics and Genes. Mendel 1865 and Today 10:00-10:30 Coffee Break 10:30-11:30 Peter Schuster, Multiplication, Mutation and Selection 11:30-12:00 Discussion Monday, Aug.22: 9:00-10:00 Eörs Szathmáry, Error Propagation in Cellular Information Processing 10:00-10:30 Coffee Break 10:30-12:00 Avshalom Elitzur, Peter Schuster, and Eörs Szathmáry, Physics, Biology, Evolution and Information – Panel Discussion
Program Tuesday, Aug.23: 9:00-10:00 Peter Schuster, Evolution Experiments in the Laboratory 10:00-10:30 Coffee Break 10:30-12:00 Contribution by Participants and Discussion Wednesday, Aug.24: 9:00-10:00 Eörs Szathmáry, Development – From Cells to Organisms 10:00-10:30 Coffee Break 10:30-12:00 Contribution by Participants and Discussion 19:00- Informal Discussion at Hotel Alpbach Thursday, Aug.25: 9:00-9:30 Peter Schuster, Primitive Forms of Learning 9:30-9:45 Hans Flohr, Semantic Information 9:45-10:30 Eörs Szathmáry, Language 10:30-11:00 Coffee Break 11:00-12:00 Avshalom Elitzur, Peter Schuster, and Eörs Szathmáry, Summary of the Seminar and Panel Discussion
Evolution and Information Peter Schuster, Institut für Theoretische Chemie, Universität Wien
Genotype, Genome Collection of genes Unfolding of the genotype Highly specific Developmental environmental program conditions Phenotype Evolution
Genotype, Genome GCGGATTTAGCTCAGTTGGGAGAGCGCCAGACTGAAGATCTGGAGGTCCTGTGTTCGATCCACAGAATTCGCACCA Omics Omi Biochemistry Unfolding of the genotype molecular biology ‘the new biology is Highly specific structural biology the chemistry of environmental living matter’ molecular evolution conditions molecular genetics systems biology bioinfomatics Phenotype evolution of RNA molecules, ribozymes and splicing, the idea of an RNA world, selection of RNA molecules, RNA editing, the ribosome is a ribozyme, small RNAs and RNA switches. Molecular evolution James D. Watson und Linus Pauling and The exciting RNA story Francis H.C. Crick Hemoglobin sequence Max Perutz Emile Zuckerkandl Gerhard Braunitzer
Earlier abstract of the ‚Origin of Species‘ Alfred Russell Wallace, 1823-1913 Charles Robert Darwin, 1809-1882 The two competitors in the formulation of evolution by natural selection
Key ingredients in Darwin‘s theory of evolution are : (i) Variations occurring spontaneously and not themselves produced by the environment, (ii) Competition for resources, so that only the best adapted survive to reproduce, and, therefore (iii) Selection by the environment, of which variants will survive and increase in number.
f 1 (A) + I 1 I 1 I 1 + f 2 Φ = ( Φ ) (A) + I 2 I 2 I 2 + dx / dt = x - x f x f i - i i i i i Φ = Σ ; Σ = 1 ; i,j f x x =1,2,...,n j j j j j i � i =1,2,...,n ; [I ] = x 0 ; i f i [A] = a = constant I i (A) + (A) + I i + + I i fm = max { ; j=1,2,...,n} fj � � � xm(t) 1 for t f m I m (A) + (A) + I m I m + f n I n (A) + (A) + I n I n + + Reproduction of individuals as basis of selection
s = ( f 2 - f 1 ) / f 1 ; f 2 > f 1 ; x 1 (0) = 1 - 1/N ; x 2 (0) = 1/N 1 Fraction of advantageous variant 0.8 0.6 s = 0.1 s = 0.02 0.4 0.2 s = 0.01 0 0 1000 200 400 600 800 Time [Generations] Selection of advantageous mutants in populations of N = 10 000 individuals
time Charles Darwin, The Origin of Species , 6th edition. Everyman‘s Library, Vol.811, Dent London, pp.121-122.
P � 4 F1 = P P 4 F1 � + + 2 + 3 F2 = F1 F1 Gregor Mendels laws of inheritance: × 2 2 2 + 2 + P F1 Versuche über Pflanzen-Hybriden. Verhandlungen des naturforschenden Vereins in Brünn , 4 : 3-47 (1865) Intermediate pair of alleles Dominant/recessive pair of alleles Presented at the Meetings of 08.02. and 08.03.1965
John Burdon Sanderson Haldane, 1892-1964 Sir Ronald Aylmer Fisher, 1890-1962 Sewall Wright, 1889-1988 The three scholars of theoretical population biology
Theodosius Dobzhansky, 1900 – 1975 „Nothing in biology makes sense except in the light of evolution.“ Evolution is the comprehensive basis of macroscopic and molecular biology
Ernst Mayr, 1904 – 2005 Author of the book: ‚The Origin of Biological Thought‘ The best known proponent of the ‚Neo-Darwinian‘ or synthetic theory of evolution which reconciled Darwinian evolutionary biology and Mendelian genetics.
James D. Watson, 1928- , and Francis Crick, 1916-2004, Nobel Prize 1962 The three-dimensional structure of a short double helical stack of B-DNA
Canonical Watson-Crick base pairs: cytosine – guanine uracil – adenine W.Saenger, Principles of Nucleic Acid Structure, Springer, Berlin 1984
Complementary replication is the simplest copying mechanism of RNA. Complementarity is determined by Watson-Crick base pairs: G � C and A = U
5' 3' G C C C G Plus Strand 5' GAA UCCCG AA GAA UCCCGUCCCG AA 3' G C C C G Plus Strand Insertion C 3' G 5' 3' G C G G G C Minus Strand GAAUCCA GAAUCC CGA A 3' 5' Deletion G C C C G Plus Strand C Point Mutation Mutations in nucleic acids represent one mechanism of variation of genotypes .
‚Replication fork‘ in DNA replication The mechanism of DNA replication is ‚semi-conservative‘
Genetic recombination as the second mechanism of variation is the molecular basis of Mendelian genetics.
Max Perutz, 1914-2002, at the opening of the Max Perutz-Library, Vienna BioCenter, in 1994 Nobel Prize 1962
Information processing in the cell
A B C D E F G H I J K L Biochemical Pathways 1 2 3 4 5 6 7 8 9 10 The reaction network of cellular metabolism published by Boehringer-Ingelheim.
The citric acid or Krebs cycle (enlarged from previous slide).
Claude Elwood Shannon, 1916 – 2001 Formulated a theory of communication and transmittal of messages through channels including error propagation. The constent of information is the negative logarithm (to the basis 2) of the probability to receive a message chosen from a given set: I = - 1.4427 log p k [bit] Computer adapted alphabet: { 0,1 }; message: 001010111010100101101.....1
Information content of a DNA sequence: I = - 1.4427 log p k [bit], where the bit refers to the binary alphabet: 0,1 GCGGATTTAGCTCAGTTGGGAGAGCGCCAGACTGAAGATCTGGAGGTCCTGTGTTCGATCCACAGAATTCGCACCA N = 76 allows for 4 76 = 5708990770823839524233143877797980545530986496 = = 5.709 � 10 45 different sequences I = - 1.4427 log (1/4 76 ) = 152 [bit] implying 2 bits per digit, since the alphabet is A,U,G,C
Questions to be analyzed and dicussed in the seminar How is biological information related to the physics of living matter and to the science of complexity? How is biological information processed in present day organisms? How did biological information originate in evolution? Can the Darwinian mechanism explain the increase in biological complexity during evolution? How did learning and language originate in societies?
Recommend
More recommend
