Design of Synthetic Genetic Systems Closing the Design Automation Loop Jean Peccoud Virginia Bioinformatics Institute Virginia Tech g
Moore’s law of synthetic genomics • The productivity of DNA sequencing has increased more than 500-fold over the past d decade. At this rate, productivity is d At thi t d ti it i doubling every 24 months. • Over the same period, the costs of sequencing have declined by more than three orders of magnitude from $1.00 per three orders of magnitude from $1 00 per base pair to less than $0.001 per base pair. • Productivity of DNA synthesis technologies has increased 700-fold over the past decade doubling every 12 the past decade, doubling every 12 months. • Costs of gene synthesis have fallen from approximately $30 per base pair to less than $1 per base pair over the same than $1 per base pair over the same period. 6/14/2010 IWBDA'10 2
It is affordable to synthesize genomes Organism Genome size (base pairs) 3.6 × 10 3 Virus, Bacteriophage MS2 F35B: $60 million Virus, SV40 5224 [ Virus Phage Φ X174; Virus, Phage Φ -X174; 5386 5386 1.9 × 10 4 Filoviruses, Ebola 1.6 × 10 5 Bacterium, Carsonella ruddii , 4 × 10 6 Bacterium, Escherichia coli 9.8 × 10 7 Nematode, Caenorhabditis elegans 1.3 × 10 8 Insect, Drosophila melanogaster aka Fruit Fly 3.2 × 10 9 Mammal, Homo sapiens 6/14/2010 IWBDA'10 3
50 years ago Complexity First transistor of current Bell Labs 1948 First Integrated circuit. g artificial artificial Five components gene networks Texas Instruments 1958 6/14/2010 IWBDA'10 4
2040: 55 mb of synthetic DNA? Pentium 4 (2000) 55 million transistors 6/14/2010 IWBDA'10 5
6/14/2010 IWBDA'10 6
Design: A controversial notion in biology gy 6/14/2010 IWBDA'10 7
Design: a transformative notion in biology gy Biology is still a science ► Still in “ discovery ” mode y o Drug discovery o Plant breeding, genetic selection o Directed evolution…. ► Trial and error is still the dominant mode of investigation ► Trial and error is still the dominant mode of investigation An engineering counterpart to biology ► Still searching for a name o Synthetic biology, genetic engineering, bioengineering… ► Main characteristics o Specify : Assume ownership of what we build o Simplify : Simple designs easy to simulate and fabricate o Simplify : Simple designs easy to simulate and fabricate o Abstract : Simple language closer to needs than solutions o Divide : Division of labor to increase productivity, size of projects 6/14/2010 IWBDA'10 8
Outline Design of biological systems ► Controversial and transformative Lessons from 40 years of EDA Lessons from 40 years of EDA ► Shrinking the size of the design space The genetic code and beyond ► DNA as a second language ► DNA as a second language CAD meets CAM ► Recoupling design and fabrication Design evaluation Design evaluation ► Coupling design and data acquisition Co ‐ design of biological systems ► Beyond the proof of concept design A shifting intellectual property landscape ► Unleashing the business potential of open source g p p 6/14/2010 IWBDA'10 9
47 Years of Design Automation Key to success 1964 ‐ 1978 1964 ‐ 1978 What do we want to emulate in biology? Research dominated by industry ► ► Main topics • Working first in silicon/DNA Circuit simulation o Logic simulation and testing • Ability of non-experts to produce working systems o Ability of non experts to produce working systems Wire routing o • Fast time to market: agile development 1979 ‐ 1993 Emergence of academic research ► ► ► Main topics Main topics Verification and testing o Layout o Logic synthesis (design o optimization) Hardware description language Hardware description language o o 1994 ‐ present ► Dominated by academic research Steadily raising the level of abstraction Major contributions… ► Alberto Sangiovanni-Vincentelli, 2003 g , 6/14/2010 IWBDA'10 10
6/14/2010 IWBDA'10 11
Integrated workflow of parts ‐ based biology Define Parts Design first pool Libraries of genetic constructs Formalize Design Principles Automated Fabricate Genetic C Construct Design t t D i C Constructs t t Define Project Goal & Performance Metrics Data Analysis Phenotype Genetic Construct Delivery Parts Calibration Constructs Accept? p Yes No Performance Evaluation Project management Project management Computing component Computing component Wet lab component Wet lab component 6/14/2010 IWBDA'10 12
Outline Design of biological systems ► Controversial and transformative Lessons from 40 years of EDA Lessons from 40 years of EDA ► Shrinking the size of the design space The genetic code and beyond ► DNA as a second language ► DNA as a second language CAD meets CAM ► Recoupling design and fabrication Design evaluation Design evaluation ► Coupling design and data acquisition Co ‐ design of biological systems ► Beyond the proof of concept design A shifting intellectual property landscape ► Unleashing the business potential of open source g p p 6/14/2010 IWBDA'10 13
Who can read this? Virginia Bioinformatics Institute (VBI) is a research institute dedicated to sciences. research pathogen-The environment to Virginia research the the study of the biological sciences. The research platform of VBI institute dedicated study of on focuses "disease the triangle" of host- focuses f on the th "di "disease triangle" t i l " of f h host-pathogen-environment t th i t I Institute (VBI) a is platform Bioinformatics of VBI interactions the i (VBI) i l f Bi i f i f VBI i i h interactions. biological. By using bioinformatics, which combines transdisciplinary approaches to and and agricultural sciences. biology synthetic. and synthetic biology. information technology and biology, researchers at VBI interpret and information technology and biology researchers at VBI interpret and By and biology, researchers at VBI interpret using bioinformatics, which By and biology researchers at VBI interpret using bioinformatics which apply vast amounts of biological data generated from basic research to to Work at combines approaches transdisciplinary VBI biology, statistics, some of today’s key challenges in the biomedical, environmental and as mathematics, computer science, information technology and apply agricultural sciences. Work at VBI involves collaboration in diverse agricultural sciences Work at VBI involves collaboration in diverse vast amounts data generated such biology from to some basic research vast amounts data generated such biology, from to some basic research disciplines such as mathematics, computer science, biology, plant today’s of key plant pathology, biochemistry, challenges in of biological pathology, biochemistry, systems biology, statistics, economics and the biomedical, diverse disciplines environmental involves collaboration synthetic biology. y gy in systems economics y The institute develops genomic, proteomic and bioinformatic tools that The of vaccine, proteomic bioinformatic tools and that can applied be to can be applied to the study of infectious diseases as well as the of the study institute infectious develops genomic, diseases well as the discovery of new vaccine, drug and diagnostic targets. as diagnostic drug targets discovery new and. 6/14/2010 IWBDA'10 14
tatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtat gagtattcaacatttccgtgtcgcccttattcccttttttgcggcattttgccttcctgtttttgc tcacccagaaacgctggtgaaagtaaaagatgctgaagatcagttgggtgcacgagtgggttacat Who can read this? cgaactggatctcaacagcggtaagatccttgagagttttcgccccgaagaacgttttccaatgat gagcacttttaaagttctgctatgtggcgcggtattatcccgtgttgacgccgggcaagagcaact tttt tt t t t t t tt t t tt t cggtcgccgcatacactattctcagaatgacttggttgagtactcaccagtcacagaaaagcatct tacggatggcatgacagtaagagaattatgcagtgctgccataaccatgagtgataacactgcggc caacttacttctgacaacgatcggaggaccgaaggagctaaccgcttttttgcacaacatggggga g g gg gg g gg g g g ggggg tcatgtaactcgccttgatcgttgggaaccggagctgaatgaagccataccaaacgacgagcgtga caccacgatgcctacagcaatggcaacaacgttgcgcaaactattaactggcgaactacttactct I do not speak DNA. agcttcccggcaacaattaatagactggatggaggcggataaagttgcaggaccacttctgcgctc Do you? Do you? ggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtat ggcccttccggctggctggtttattgctgataaatctggagccggtgagcgtgggtctcgcggtat cattgcagcactggggccagatggtaagccctcccgtatcgtagttatctacacgacggggagtca ggcaactatggatgaacgaaatagacagatcgctgagataggtgcctcactgattaagcattggta actgtcagaccaagtttactcatatatactttagattgatttaaaacttcatttttaatttaaaag gatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttcca ctgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaat ctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctacc aactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgta aactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgta gccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcct gttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagtt accggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaac gacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggag aaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagg gggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgattttt 6/14/2010 IWBDA'10 15 gtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcct
Learning DNA as a second language… Pattern recognition Modeling 6/14/2010 IWBDA'10 16
Recommend
More recommend
