What is a BioBot? Biological robot programmed to sense, interac t - PowerPoint PPT Presentation

What is a BioBot?

Biological robot programmed to sense, interac t ¡ with environment

What would make a good BioBot?

Multiple Configurations

What are the naturally occurring cell sensors that interact with the human body?

Integrins • Previous attempts to express integrins on bacterial cells were unsuccessful • Differences in the intercellular organizations of mammalian and bacterial cells • We propose to redesign the integrin extracellular sequence and use bacterial display technologies to solve these issues

What are the synthetic biology tools that we need to achieve this goal?

Our Project Transcribe ¡ RBS PCR (1) ¡ Assembly PET-mCherry Transport ¡ Z-Domain (2) ¡ Dimerize ¡ Split GFP (3) ¡ Bind ¡ligand ¡ KQAGDV-GFP (4) ¡

Our Project

Z-domain KQAGDV-GFP Split GFP PET-mCherry RBS Primer Outreach

RBS PCR Assembly RBS ¡ ATG ¡ Prefix ¡ BioBrick ¡ Suffix ¡ Transcribe ¡

RBS PCR Assembly ATG ¡ Prefix ¡ BioBrick ¡ Suffix ¡ Duplex ¡InserFon ¡ ¡ ¡ ¡ ¡ ¡ ¡ ¡ ¡ ¡ ¡ ¡3A ¡Assembly ¡ ¡ ¡ ¡ ¡ ¡ ¡ ¡ ¡ ¡Standard ¡Assembly ¡ ATG ¡ RBS ¡ Prefix ¡ BioBrick ¡ Suffix ¡ Transcribe ¡

RBS PCR Assembly [1] ¡ Transcribe ¡

RBS Primer Design Back-Bone Prefix Part T G A A T T C G C G G C C G C A T G T T C T A G G EcoRI � XbaI � A A A G A G G A G A A A T A C T A G Ribosomal Binding Site Scar Transcribe ¡

Primer Testing iGEM ¡Kit ¡ ATG ¡Parts ¡from ¡iGEM ¡Well ¡Plates ¡ PCR ¡ reac6on ¡ Transcribe ¡

Primer Testing • Amplification indicates presence of site • Amplification of 21/24 BioBricks from plate Unsuccess ful ¡ 12% ¡ Successful ¡ 88% ¡ Transcribe ¡

RBS Primer New RBS 3A Assembly Primer Time 15 min active 48 hr process 2 hr PCR Labor No Yes Intensive? < 10% Success 87.5% Rate Cost $ $$$$ Transcribe ¡

RBS PCR Assembly Sense Primer: RBS Primer EcoRI XbaI RBS Scar TGGAATTCGCGGCCGCTTCTAGAGAAAGAGGAGAAATACTAGATG Antisense Primer: Standard Antisense Sequencing Primer (VR) GTATTACCGCCTTTGAGTGA Transcribe ¡

PET-mCherry How do we transport sensors to the surface of cells? Transcribe ¡ Transport ¡

Autodisplay [3] ¡ SP ¡ ¡ ¡passenger ¡ ¡ ¡ ¡ ¡ ¡linker ¡β-­‑barrel ¡ autotransporter ¡ Transcribe ¡ Transport ¡

PET-mCherry Prefi Suffix mCherry x SP passenger linker β -barrel T7 + LacI + • Optimized for E. RBS coli • Removal of Standard 10 restriction sites • Addition of T7, lacI, and RBS • Packaged for [3] ¡ Biobrick Standard Transcribe ¡ Transport ¡ 10

PET-mCherry gBlock Assembly Transcribe ¡ Transport ¡

PET-mCherry PET_mCherry Expression through IPTG NovaBlue (DE3) E. coli induction! Nitrocellulose Paper IPTG Plate Transcribe ¡ Transport ¡

PET-mCherry • Characterization using: • Flow cytometry • Immunostaining • Monoclonal mouse and polyclonal rabbit Ab • Secondary fluorescently tagged anti- Transcribe ¡ Transport ¡ mouse or anti- rabbit ¡

PET-mCherry Pet-­‑mCherry ¡ Pet-­‑mCherry ¡IPTG ¡ Control ¡+ ¡IPTG ¡ Control ¡ Transcribe ¡ Transport ¡

Does LacI work? YES! Transcribe ¡ Transport ¡

Is PET-mCherry extracellularly expressed? Most Likely… Transcribe ¡ Transport ¡

Z-domain What is an alternative to autotransporters? [3] ¡ Transcribe ¡ Transport ¡

Z-domain • IgG binding domain that naturally occurs in staphylococcus aureus • Redesigned for E. coli Z domain E. ¡coli ¡ • Double binding site Sense Zdomain Antisense Zdomain PRM 1 PRM 2 Transcribe ¡ Transport ¡

Z Domain Alph subu Be su Z ¡ Domain ¡ Z ¡ Domain ¡ E. Coli Cell Transcribe ¡ Transport ¡

Split GFP How do we characterize dimerization? Transcribe ¡ Transport ¡ Dimerize ¡

Split GFP • Sequence on Registry is correct • However restriction digest found EcoRI site • Site directed mutagenesis used to correct error PstI (722 ) BBa SENSE ANTISEN BBa k916003 PRM B0034 SE PRM EcoRI pSB1A3 Bba K916003 Bba B0034 RBS splitGFP 2937 bp Transcribe ¡ Transport ¡ Dimerize ¡

KQAGDV-GFP How do we determine active binding after dimerization? Transcribe ¡ Transport ¡ Dimerize ¡ Bind ¡Ligand ¡

KQAGDV-GFP • Binding region of fibrinogen fused with fluorescent protein • Fibrinogen is the natural ligand for α 2b β 3 integrins KQAG DV Transcribe ¡ Transport ¡ Dimerize ¡ Bind ¡Ligand ¡

• BioBot ¡v.1 ¡ Summary of Work Transcribe ¡ RBS Primer (1) ¡ PET-mCherry Transport ¡ Z-Domain (2) ¡ Dimerize ¡ Split GFP (3) ¡ Bind ¡ligand ¡ KQAGDV-GFP (4) ¡ Prefix ¡ BioBrick ¡

• BioBot ¡v.1 ¡ Outreach • Work ¡with ¡Nicole ¡Chapman ¡from ¡ Core]a ¡Sco] ¡King ¡Women’s ¡School ¡ • Aid ¡the ¡Lambert ¡High ¡School ¡iGEM ¡ Team ¡

Working with Nicole Chapman • Chemistry ¡and ¡Biotechnology ¡teacher ¡at ¡ Core]a ¡Sco] ¡King ¡School ¡ • ¡Founding ¡a ¡high ¡school ¡iGEM ¡Team ¡

Helping Lambert High School Is HybB a cold-shock promoter?

Helping Lambert High School HybB ¡Promoter ¡ HybB ¡ YFP ¡ Control ¡Promoter ¡ fdrA ¡ CFP ¡

Helping Lambert High School No ¡InducFon ¡ Cold ¡Shock ¡Induced ¡ There is no HybB ¡-­‑ ¡YFP ¡ HybB ¡-­‑ ¡YFP ¡ difference! Control ¡-­‑ ¡CFP ¡ Control ¡-­‑ ¡CFP ¡

Recap Although we did not end up expressing the integrin, major steps have been made towards our goal: • The development of the standard RBS primer • Indications that PET mCherry (large autotransporter) is expressed on cell surface • Developed alternative autotransporter with Z- Domain • Fixed Split GFP from previous years, which can indicate presence of expressed integrins • Introduced iGEM to Coretta Scott King High School • Helped Lambert iGEM through experimentation with hybB promoter

• BioBot ¡v.1 ¡ Future Work • Fuse α IIb β 3 integrin subunits to an autotransporter or IgG binding domain (Z Domain) • Characterize our BioBot interaction

• BioBot ¡v.1 ¡ Parts BBa_K1156000 Pet_mcherry BBa_K1156001 Z domain BBa_K1156002 GFP-KQAGDV BBa_K1156003 T7-lacI BBa_K1156004 RBS-NGFP BBa_K1156005 RBS-CGFP BBa_K9160003 NGFP BBa_K1156006 T7lacIrbsGFPN BBa_K1156007 T7lacIrbsKQAGDV BBa_K1156008 T7LacIrbsGFPC T7lacIrbsNGFPrbsCG BBa_K1156009 FP

The Team Team Members: Rachael Blackstone Tilak Balavijayan Haoli Du Jack Jenkins Spencer Cooper Casey Haynes Jessica Siemer Facilitators: Dr. Anton Bryksin Haylee Bachman Vince Fiore

Acknowledgements Thank you to all the people and companies that made Georgia Tech iGEM possible! • Georgia Tech Biomedical Engineering Department • Macrogen USA • Integrated DNA Technologies • VWR • Dr. Thomas Barker • Dr. Robert Guldberg • Dr. Larry McIntire • Dr. Ravi Bellamkonda • Dr. Esfandiar Behravesh • Dr. Mark Styczynski • Dr. M.G. Finn • Dr. Brian Hammer • Dr. Kirill Lobachev • Dr. Gang Bao • Dr. Eric Gaucher • Dr. Barbara Fasse • Edward Burdette • Jesus Mata-Acosta

Resources 1. Bryksin, A. V., & Matsumura, I. (2010). Overlap extension PCR cloning: a simple and reliable way to create recombinant plasmids. BioTechniques , 48 (6), 463. 2. By Integrin.png:Juergen Bode at de.wikipedia derivative work: Odysseus1479 (Integrin.png) [CC-BY-SA-3.0 (http:// creativecommons.org/licenses/by-sa/3.0)], from Wikimedia Commons 3. Sevastsyanovich et al. Microbial Cell Factories 2012, 11:69 Page 3 of 10 4. PCR tubes [Web Photo]. Retrieved from http://www.bioworld.com/siteaccounts/masterfiles/IMAGES/ PI-11190019.jpg 5. 96 well plate [Web Photo]. Retrieved from http://www.4ti.co.uk/files/cache/ e7199a9f456dacab058c6be0b54e9235.jpg 6. Brown, S. D., Fiedler, J. D., & Finn, M. G. (2009). Assembly of hybrid bacteriophage q β virus-like particles. Biochemistry, (48), 11155–11157. Retrieved from http://pubs.acs.org/doi/ pdf/10.1021/bi901306p

Thank you! Questions?