UCSF 2013 Operation CRISPR: Operation CRISPR: Deploying - PowerPoint PPT Presentation

UCSF 2013 Operation CRISPR: Operation CRISPR: Deploying ¡precision ¡guided ¡tools ¡to ¡target ¡ unique ¡species ¡in ¡a ¡complex ¡microbiome ¡

Microbiomes ¡play ¡an ¡important ¡role ¡in ¡ human ¡and ¡environmental ¡health ¡ Disruption of the balance in the microbiome is linked to many diseases. 2 ¡

3 ¡

Current ¡methods ¡of ¡manipula9ng ¡ microbiomes ¡are ¡nonspecific ¡ Antibiotics Indiscriminant killing of good and bad bacteria 4 ¡

CHALLENGE: ¡ ¡how ¡do ¡we ¡target ¡specific ¡ bacteria ¡within ¡the ¡complex ¡microbiome ¡ popula9on ¡? ¡ ? 1. How do we target one species in a population? 2. How do we give selected species nuanced instructions? 5 ¡

Our ¡Goals ¡ Tool: CRISPRi 1. Design genetic system that can target selected species in microbiome 2. Design system that can modulate targeted species in nuanced way: - eg. Regulation of growth, gene silencing, cell death 6 ¡

Introducing ¡CRISPRi ¡to ¡a ¡bacterial ¡ community ¡ Why use CRISPRi? • CRISPRi utilizes gRNAs • Highly specific and customizable • Can take advantage of unique DNA sequences to target specific bacterial species 7 ¡ Amended from: Qi, et al . Cell, 2013

How ¡do ¡we ¡use ¡CRISPRi ¡in ¡the ¡ microbiome ¡? ¡ CHALLENGES: 1. How do we introduce and spread CRISPRi system throughout microbiome? Conjugation with CRISPRi 8 ¡

1. ¡Conjuga9on ¡as ¡Delivery ¡Method ¡ ¡ Chromosomal ¡ ¡ Chromosomal ¡ ¡ DNA Conjuga9ve ¡ Conjuga9ve ¡ DNA plasmid plasmid Donor ¡cell Recipient ¡Cell Conjugation is a naturally occurring mechanism bacteria use to transfer DNA. 9 ¡

How ¡do ¡we ¡use ¡CRISPRi ¡in ¡the ¡ microbiome ¡? ¡ CHALLENGES: 1. How do we introduce and spread CRISPRi system throughout microbiome? Conjugation with CRISPRi 2. How do we use CRISPRi to manipulate target bacteria? Synthetic CRISPRi circuits 10 ¡

2. ¡CRISPRi ¡Circuits ¡can ¡be ¡used ¡to ¡give ¡a ¡ selected ¡bacteria ¡specific ¡instruc9ons ¡ ¡ Chemical Signal #1 Chemical Signal #2 Elicit Response #2 Elicit Response #1 11 ¡

Specific ¡Bacterial ¡Targe9ng: ¡ ¡ Conjuga9on ¡with ¡CRISPRi ¡ Gene of Interest Chromosomal DNA CRISPRi Target Cell Chromosomal DNA Conjugative Untargeted Gene plasmid Chromosomal DNA Donor Cell Untargeted Cell 12 ¡

Combining CRISPRi ¡ and ¡Conjuga9on CRISPRi Chromosomal dCas9 DNA Conjugative P Tet plasmid tetR P c gRNA Conjugative plasmid Engineered ¡donor ¡cell 13 ¡

Transfer ¡of ¡Conjuga9ve ¡Plasmid ¡ from ¡Donor ¡to ¡Pathogen ¡ Gene ¡of ¡Interest CRISPRi Chromosomal Chromosomal DNA Conjugative DNA Conjugative plasmid plasmid Engineered ¡donor ¡cell Target ¡Cell 14 ¡

Inhibi9on ¡of ¡Gene ¡Expression ¡ by ¡CRISPRi ¡ Gene of Interest AACTTTCAGTTTAGCGGTCTCCC TTGAAAGTCAAATCGCCAGAGGG Gene of Interest Chromosomal Conjugative DNA plasmid dCas9 AACUUUCAGUUUAGCGGUCU gRNA Target Cell dCas9 AACUUUCAGUUUAGCGGUCU gRNA P Tet dCas9 tetR P c gRNA 15 ¡

Proof ¡of ¡Concept: ¡RFP ¡Repression ¡ RFP CRISPRi Chromosomal Chromosomal DNA DNA Conjugative plasmid Target Cell Donor Cell 16 ¡

Does conjugation work? Can CRISPRi system knock down RFP expression? Gene of Interest CRISPRi Chromosomal Chromosomal DNA Conjugative DNA Conjugative plasmid plasmid Can we transfer the CRISPRi system by conjugation? 17 ¡

Conjuga9on ¡Assay ¡between ¡Donor ¡ and ¡Recipient ¡Strains ¡ Number of Transconjugants over Time Cell Density (Cells/mL) x10 5 25 20 15 10 5 0 0h 2h 5h 8h Donor (carbenicillin, from plasmid) Recipient (chloramphenicol) Recipient + Plasmid, “Transconjugant” (carb + cam) 18 ¡

ü Conjugation works Can CRISPRi system knock down RFP expression? Gene of Interest CRISPRi Chromosomal Chromosomal DNA Conjugative DNA Conjugative plasmid plasmid Can we transfer the CRISPRi system by conjugation? 19 ¡

Does ¡our ¡CRISPRi ¡system ¡work? ¡ RFP Chromosomal DNA Target Cell 20 ¡

Knock-­‑Down ¡of ¡RFP ¡with ¡Directly ¡ Transformed ¡CRISPRi ¡ Mean RFP Fluorescence (a.u.) 10 4 10 3 10 2 Control + CRISPRi 21 ¡

ü Conjugation works ü ¡ ¡ CRISPRi system knocks down RFP expression Gene of Interest CRISPRi Chromosomal Chromosomal DNA Conjugative DNA Conjugative plasmid plasmid Can we transfer the CRISPRi system by conjugation? 22 ¡

Conjuga9on ¡of ¡CRISPRi ¡System: ¡ RFP ¡Knock-­‑down ¡via ¡Flow ¡Cytometry ¡ Conjugation Control Mean RFP Fluorescence (a.u.) 10 4 gRNA(+), dCas9(+) Count 10 3 10 2 0 gRNA(+), dCas9(+) 0 10 2 10 3 10 4 10 5 mRFP 23 ¡

ü Conjugation works ü ¡ ¡ CRISPRi system knocks down RFP expression Gene of Interest CRISPRi Chromosomal Chromosomal DNA Conjugative DNA Conjugative plasmid plasmid ü We can transfer the CRISPRi system by conjugation! 24 ¡

Is ¡There ¡Any ¡Non-­‑Specific ¡Targe9ng? ¡ RFP GFP CRISPRi Chromosomal Chromosomal DNA Conjugative DNA Conjugative plasmid plasmid Strain kindly provided by Stanley Qi, UCSF 25 ¡

Demonstra9ng ¡the ¡Specificity ¡of ¡ CRISPRi ¡ Mean RFP Fluorescence (a.u.) Mean GFP Fluorescence (a.u.) 10 3 10 5 10 4 10 3 10 2 10 2 26 ¡

Our ¡CRISPRi ¡conjuga9on ¡system ¡is… ¡ ¡ ¡Transferable ¡ ¡ RFP GFP Chromosomal ¡ ¡ DNA Conjugative plasmid RFP GFP ¡Tunable ¡ ¡ Chromosomal DNA Conjugative ¡ ¡ Gene of Interest plasmid CRISPRi Chromosomal Chromosomal DNA Conjugative DNA Conjugative ¡Scalable ¡ ¡ plasmid plasmid ¡ ¡ AACUUUCAGUUUAGCGGUCU gRNA AACUUUCAGUUUAGCGGUCU gRNA ¡Specific ¡ ¡ 27 ¡

CRISPRi ¡Specificity ¡in ¡a ¡Co-­‑culture ¡ RFP Chromosomal DNA CRISPRi Chromosomal Target Cell DNA Conjugative plasmid YFP Chromosomal DNA Donor Cell Untargeted Cell 28 ¡

Future ¡direc9ons ¡of ¡CRISPRi ¡ Conjuga9on ¡System ¡ • Targeting endogenous genes • Conjugation between different species • Transfer of complex instructions, such as synthetic circuit 29 ¡ http://www.denniskunkel.com/

How ¡do ¡we ¡use ¡CRISPRi ¡in ¡the ¡ microbiome ¡? ¡ CHALLENGES: 1. How do we introduce and spread CRISPRi system throughout microbiome? Conjugation with CRISPRi 2. How do we use CRISPRi to manipulate target bacteria? Synthetic CRISPRi circuits 30 ¡

CRISPRi ¡Circuits ¡can ¡be ¡used ¡to ¡give ¡a ¡ selected ¡bacteria ¡specific ¡instruc9ons ¡ ¡ Low chemical High Chemical signal Signal Response #2 Response #1 31 ¡

Desired ¡Output ¡of ¡CRISPRi ¡Circuit ¡ LEGEND Response #1 Response #2 32 ¡

Desired ¡Promoter ¡Sensi9vity ¡ 33 ¡

Decision ¡Making ¡with ¡CRISPRi ¡ ¡ GFPi ¡ RFP ¡ Chemical ¡ Signal ¡ GFP ¡ RFPi ¡ dCas9 ¡ KEY ¡ ¡ ¡ ¡ ¡ ¡ ¡High ¡Promoter ¡ ¡ ¡ ¡ ¡ ¡Low ¡Promoter ¡ ¡ ¡ ¡ ¡ ¡Interference ¡ i ¡ ¡ 34 ¡

Low ¡Inducer ¡Level ¡ à ¡GFP ¡ GFPi ¡ RFP ¡ H GFP Chemical ¡ Signal ¡ Low ¡ concentra?on ¡ GFP ¡ RFPi ¡ L KEY ¡ ¡ ¡ ¡ ¡ ¡ ¡High ¡Promoter ¡ H ¡ ¡ ¡ ¡ ¡Low ¡Promoter ¡ L ¡ ¡ ¡ ¡ ¡Interference ¡ i ¡ ¡ 35 ¡

High ¡Inducer ¡Level ¡ à ¡RFP ¡ GFPi ¡ RFP ¡ High ¡ H concentra?on ¡ RFP Chemical ¡ Signal ¡ GFP ¡ L RFPi ¡ KEY ¡ ¡ ¡ ¡ ¡ ¡ ¡High ¡Promoter ¡ H ¡ ¡ ¡ ¡ ¡Low ¡Promoter ¡ L ¡ ¡ ¡ ¡ ¡Interference ¡ i ¡ ¡ 36 ¡

Desired ¡Promoter ¡Ac9vity ¡ High ec50 Low ec50 To confer this decision making ability, we need two promoters that respond differently to the same inducer 37 ¡

Characterizing ¡pLAC ¡& ¡pTET ¡ promoters ¡ We want: • Low Basal Level • Wide Dynamic Range pLAC Dose Response Curve pTET Dose Response Curve 38 ¡

Addi9onal ¡Repressor ¡Sites ¡Can ¡ Alter ¡Promoter ¡Behavior ¡ LacI Lac O1 Lac O3 LacI Lac O1 39 ¡ Oehler et al. , Nucleic Acids Research, 2006

Engineering ¡pLAC ¡Sensi9vity ¡ -140 -35 -10 +1 TSS (A) Original (BBa_R0011) lacO1 lacO1 (B) Engineered lacO3 lacO1 lacO1 40 ¡

Redesigned ¡pLAC ¡ à ¡Lower ¡ Dynamic ¡Range ¡ pLAC_engineered ¡ pLAC_original ¡ Hill Fit of pLAC_engineered pLAC original Hill Fit of pLAC_originial ¡ pLAC engineered ec50 ec50 41 ¡

Improved ¡Designs ¡for ¡Low ¡& ¡High ¡ Level ¡Promoters ¡ -140 -35 -10 +1 TSS (A) Original (BBa_R0011) lacO1 lacO1 Engineered (B) lacO3 lacO1 lacO1 (C) Low lacO1 High (D) lacO1 lacO3 42 ¡