synthetic minimal chromosome
play

Synthetic Minimal Chromosome 2010 CBNU-KOREA team genetic - PowerPoint PPT Presentation

Synthetic Minimal Chromosome 2010 CBNU-KOREA team genetic information necessary and sufficient to sustain a functioning chromosome. chromosome. WHAT is a Minimal Chromosome? The minimal chromosome contains the minimal set of It is a


  1. Synthetic Minimal Chromosome 2010 CBNU-KOREA team

  2. genetic information necessary and sufficient to sustain a functioning chromosome. chromosome. WHAT is a Minimal Chromosome? • The minimal chromosome contains the minimal set of • It is a self-replicating chromosome compatible with a host • It includes more than one essential gene for viability.

  3. system and one essential gene for viability. Minimal Chromosome vs. Minimal Genome Theoretically, the smallest minimal chromosome contains self replicating Ⅱ Ⅰ Ⅱ Ⅲ Ⅲ Ⅰ Genome = Chr I + Chr II + Chr III Minimal Genome = MC I + MC II + MC III

  4. Minichromosome oriC plasmid More than one essential gene for other function Essential genes for chromosome replication & segregation oriC Minimal Chromosome Minimal Chromosome vs. Minichromosome Bottom up

  5. Normal Cell Minimal Chromosome Minimal Genome Minimal Cell

  6. Construction of a Minimal Chromosome will be a very important foundational advance in Synthetic Biology Vaccines Therapeutic Diagnostics Bio-fuels Bioremediation Drug Biomedicine Biomaterials Food Ingredients Synthetic Biology Biosensor Fine Chemicals Minimal Genome Minimal Chromosome

  7. Types of gene gens arrangement gene order codon usage direction of gene genome structure metabolic pathway metabolites interaction genome stability Statistically analysis Environmental effect RNA structure RNA interaction WHY Minimal Chromosome? Design and Synthesis of the Minimal Genome is difficult.

  8. DESIGN & SYNTHESIS So, we need

  9. DB & PROGRAM

  10. Concept

  11. Concept Genebank Data(.GB) • Used NCBI and DEG Information. • This Program Based Artemis. • Show Gene's Essential-Gene. – Mapping DEG E-Gene and Custom’s – Artemis used showing tools

  12. Gene Bank Format File E-Gene Information Loading GB File Principle- ① CBNU_KOREA DATABASE Gene information 04 05 06 07 08 09 10

  13. COG Code E-Gene Loading DB Information Principle- ② CBNU_KOREA Gene Bank DATABASE Format File E-GeneTable Gene information 01 M 04 05 L 05 10 A 06 13 C 07 40 H 08 69 D 09 80 D 10

  14. Information E-Gene DB&GB Matching Principle- ③ CBNU_KOREA Gene Bank DATABASE Format File E-GeneTable Gene information 01 M 04 05 L 05 10 A 06 13 C 07 40 H 08 69 D 09 80 D 10

  15. Information E-Gene Apply Color Principle- ④ CBNU_KOREA Gene Bank DATABASE Format File E-GeneTable Gene information 01 M 04 05 L 05 10 A 06 13 C 07 40 H 08 69 D 09 80 D 10

  16. Drawing Diagram Principle- ⑤ 4 5 6 7 8 9 10

  17. extendible. Database • Based DEG and NCBI • Mapping by GI number • Schema is right follows. • Schema designed for • Surface, function parsing

  18. DEG MATCHING DEG’s Number NCBI MATCHING NCBI Store MySQL Server Strore Database If you want to see it, you access website http://synb.chungbuk.ac.kr Database • Make list of • Matching DEG list • All information • Add DEG data • Add NCBI data

  19. gene and color of I want essential essential gene! uu… Original Artemis

  20. Genome Designer

  21. Wonderful !! WOW !!! It ‘s Good !! Thank you^^ How about it?

  22. Genome Designer preciously described database and GB. program. and color of essential gene. • We implemented this feature using • This feature is added to the Artemis • Genome Designer show essential gene

  23. Flow Chart(Overall) Next GB data Block Print START Yes END GB data Matching? Essential Gene DB Represent End of GB data? Yes No No

  24. Making Parts

  25. resistance Chloramphenicol PrctB PrctB(syn) 14-mer PrctA IHF site 11-mers rctA rctB DnaAbox AT-rich 12-mer Minimal Chromosome Promoter BBa_J61100 par parS dif parB - gfp A

  26. V. cholerae chromosome II Replication system rctB rctA oriVIIvc Partition system parA parB parS Termination system dif BioBrick vector and parts

  27. rctA-ori BBa_K307107 rctB BBa_307105 PrctB syn BBa_307104 BioBrick for Replication rctB rctA oriVIIvc Primer PrctB 14-mer IHF site PrctA 11-mers E X S P rctA DnaAbox AT-rich Primer 12-mer PrctB(syn) Primer E X S P rctB E X S P Primer PrctB(syn) 14-mer PrctA IHF 11- site mers DnaAbo rctA rctB x AT-rich 12-mer

  28. V. cholerae chromosome II replication system oriCIIvc 14-mer PrctA PrctB IHF site 11-mers rctA rctB DnaAbox AT-rich 12-mer In V. cholerae

  29. P rct B was not strong for working in E. coli oriCIIvc In E. coli 14-mer PrctA PrctB IHF site 11-mers rctA rctB DnaAbox AT-rich 12-mer

  30. Synthesis P rct B with storng promoter and strong ribosome binding site. ATTTTTCTTTATTTATGATCTCTTTTTCTTTATTCTCTTGGAACTATAGTGATATTACGGTAAGTGTGATACGGATC RBS -35 R13 -10 ATTTTTCTTGACATATACTATGATCTCTTTTTCTTTATAATCTTGGAACTATAGTGATATTACGGTAAGTGTAAGGAGGTGAGGATC PrctB(syn) RBS -35 R13 -10 PrctB P rct B(Syn) 14-mer PrctA IHF site 11-mers rctA rctB DnaAbox AT-rich 12-mer

  31. parA BBa_307103 parB BBa_307106 parS BBa_307101 Promoter BBa_J61100 BBa_K125500 gfp BioBrick for Partition parA parB parS Primer Primer E X S P E X S P parB parA Primer Primer Primer E X S P parS Primer Promoter BBa_J61100 S P E X parB - gfp parA

  32. parS site parB parB - gfp ParB- parS complex ParB-GFP fusion protein …GTTTACAGTGTAAAT… Partition System of a Minimal Chromosome ParB

  33. Chloramphenicol PCR Primer Modified Vector C N resistance Chloramphenicol BioBrick Vector resistance pSB1C3 (pMB1) PCR Primer Rep Modified Vector E X BBa_J _J04450 4450 SP NheI NheI BBa_J _J04450 4450 E X SP NheI NheI

  34. Future Work

  35. Minimal Chromosome for iGEM2011

Recommend


More recommend