supplemental figure s1
play

Supplemental Figure S1: a) NB1 NB3 NB4 NB8 NB15 pPKB(Ser473) - PDF document

Jan 29, 2023 •333 likes •434 views

Supplemental Figure S1: a) NB1 NB3 NB4 NB8 NB15 pPKB(Ser473) PKB(total) GAPDH b) NB1 NB3 Infect. - + - + FOXO3(A3)ER TM ectopic FOXO3 endogenous 1.3 7.8 ratio ectopic/endogenous GAPDH c) Magnification Merge

  1. Supplemental Figure S1: a) NB1 NB3 NB4 NB8 NB15 pPKB(Ser473) PKB(total) GAPDH b) NB1 NB3 Infect. - + - + FOXO3(A3)ER TM ectopic FOXO3 endogenous 1.3 7.8 ratio ectopic/endogenous GAPDH c) Magnification Merge (neg Ctr) Hoechst FOXO3 Merge FOXO3 Merge NB1 NB3

  2. Supplemental Figure S2: a) 60 60 60 24h NB1/Ctr 48h NB1/Ctr 72h NB1/Ctr NB1 NB1/FOXO3 NB1/FOXO3 NB1/FOXO3 50 50 50 40 40 40 % cell death % cell death % cell death 30 30 30 20 20 20 10 10 10 0 0 0 0 nM 25 nM 50 nM 100 nM 250 nM 500 nM 0 nM 25 nM 50 nM 100 nM 250 nM 500 nM 0 nM 25 nM 50 nM 100 nM 250 nM 500 nM 4OHT 4OHT 4OHT 60 60 60 NB3 24h NB3/Ctr 48h NB3/Ctr 72h NB3/Ctr NB3/FOXO3 NB3/FOXO3 NB3/FOXO3 50 50 50 40 40 40 % cell death % cell death % cell death *** *** ** ** 30 30 30 *** ** ** ** ** 20 20 20 10 10 10 0 0 0 0 nM 25 nM 50 nM 100 nM 250 nM 500 nM 0 nM 25 nM 50 nM 100 nM 250 nM 500 nM 0 nM 25 nM 50 nM 100 nM 250 nM 500 nM 4OHT 4OHT 4OHT 60 60 60 24h NB4/Ctr 48h NB4/Ctr 72h NB4/Ctr NB4 NB4/FOXO3 NB4/FOXO3 NB4/FOXO3 50 50 50 40 40 40 % cell death % cell death % cell death 30 30 30 20 20 20 10 10 10 0 0 0 0 nM 25 nM 50 nM 100 nM 250 nM 500 nM 0 nM 25 nM 50 nM 100 nM 250 nM 500 nM 0 nM 25 nM 50 nM 100 nM 250 nM 500 nM 4OHT 4OHT 4OHT 60 60 60 24h NB8/Ctr 48h NB8/Ctr 72h NB8/Ctr NB8 NB8/FOXO3 NB8/FOXO3 NB8/FOXO3 50 50 50 40 40 40 % cell death % cell death % cell death 30 30 30 20 20 20 10 10 10 0 0 0 0 nM 25 nM 50 nM 100 nM 250 nM 500 nM 0 nM 25 nM 50 nM 100 nM 250 nM 500 nM 0 nM 25 nM 50 nM 100 nM 250 nM 500 nM 4OHT 4OHT 4OHT 60 60 60 72h NB15/Ctr 24h NB15/Ctr 48h NB15/Ctr NB15 NB15/FOXO3 NB15/FOXO3 NB15/FOXO3 50 *** 50 50 *** *** *** ### 40 40 40 ** % cell death % cell death % cell death ## *** ** ### *** 30 30 *** 30 ** 20 20 20 10 10 10 0 0 0 0 nM 25 nM 50 nM 100 nM 250 nM 500 nM 0 nM 25 nM 50 nM 100 nM 250 nM 500 nM 0 nM 25 nM 50 nM 100 nM 250 nM 500 nM 4OHT 4OHT 4OHT

  3. b) NB4/FOXO3 NB8/FOXO3 24 h 48 h 72 h 24 h 48 h 72 h 63.0% 63.0% 57.0% 57.0% 52.0% 52.0% 55.1% 55.1% 53.2% 53.2% 60.5% 60.5% - 4OHT - 4OHT 11.7% 11.7% 15.4% 15.4% 14.4% 14.4% 13.9% 13.9% 13.7% 13.7% 12.6% 12.6% 9.7% 9.7% 11.3% 11.3% 12.9% 12.9% 12.5% 12.5% 14.6% 14.6% 8.8% 8.8% 62.6% 62.6% 56.7% 56.7% 57.7% 57.7% 57.8% 57.8% 57.1% 57.1% 59.3% 59.3% + 4OHT + 4OHT 10.6% 10.6% 14.3% 14.3% 13.2% 13.2% 12.9% 12.9% 13.4% 13.4% 12.8% 12.8% 11.2% 11.2% 8.7% 8.7% 11.3% 11.3% 14.1% 14.1% 12.9% 12.9% 8.8% 8.8% NB15/FOXO3 24 h 72 h 48 h 49.7% 49.7% 54.0% 54.0% 51.7% 51.7% 23.2% 23.2% 21.8% 21.8% 26.0% 26.0% - 4OHT 14.3% 14.3% 10.4% 10.4% 12.1% 12.1% 67.6% 67.6% 34.6% 34.6% 61.7% 61.7% + 4OHT 12.5% 12.5% 7.0% 7.0% 6.2% 6.2% 9.9% 9.9% 8.1% 8.1% 13.8% 13.8%

  4. Supplemental Figure S3: 200 NB4/FOXO3 180 NB8/FOXO3 160 BCLXL mRNA expression NB15/FOXO3 (fold over control) 140 120 100 80 *** 60 *** *** *** 40 20 0 0h 3h 6h 9h 140 NB4/FOXO3 NB8/FOXO3 120 BIRC5 mRNA expression NB15/FOXO3 100 (fold over control) 80 ** *** *** 60 40 20 0 0h 3h 6h 9h

  5. Supplemental Figure S4: a) 60 NB4/FOXO3 BIM_02 methylation (PMR %) NB8/FOXO3 50 NB15/FOXO3 40 30 ** 20 * 10 0 untreated 4OHT 5-azadC b) Input IP:FOXO3 IP:IgG NB15 NB4 NB8 NB15 NB4 NB8 NB15 FOXO3 Ac-FOXO3 1.02 0.98 1.43 0.0 % Ac-FOXO3/IP-FOXO3 Tubulin

  6. Supplemental Figure S5: NB1 TP53 (homo sapiens) 393 aa 1 44 102 292 325 356 NB3 TAD TET DNA-binding domain Mutation site codon 72 Pro → Arg (C→G) TP53 wt TP53 NB1 * TP53 NB3 NB4 TP53 NB4 TP53 NB8 TP53 NB15 NB8 NB15

  7. Supplemental Figure S6: 3 NB15 0h Etop NB15 2h Etop * (fold over control) NB15 4h Etop mRNA expression * * 2 * 1 0 BIM NOXA SESN3 5 NB4 0h Etop * NB4 2h Etop NB4 4h Etop 4 (fold over control) mRNA expression ** 3 2 1 0 BIM NOXA SESN3 4 NB8 0h Etop NB8 2h Etop ** NB8 4h Etop (fold over control) mRNA expression 3 *** 2 # # 1 *** * 0 BIM NOXA SESN3

  8. Supplemental Figure S7: NB1/Ctr NB1/FOXO3 control Etop Doxo control Etop Doxo - 4OHT + 4OHT 120 120 without 4OHT without 4OHT with 4OHT with 4OHT 100 100 80 colonies [%] 80 colonies [%] 60 ** 60 * 40 40 ### ## 20 20 0 0 untreated Etop Doxo untreated Etop Doxo NB1/Ctr NB1/FOXO3

  9. Supplemental Figure S8: a) 120 120 100 SESN3 mRNA expression 100 SESN3 mRNA expression (fold over control) (fold over control) 80 *** 80 60 *** 60 40 40 20 20 0 0 NB8/FOXO3-shCtr NB8/FOXO3-shSESN3 NB4/FOXO3-shCtr NB4/FOXO3-shSESN3 b) NB8/FOXO3-shCtr NB8/FOXO3-shSESN3 300 untreated untreated Etop untreated Etop 2h Etop 250 ROS % of untreated Ctr Bright field 200 * 150 100 CM-H 2 XROS 50 0 NB8/FOXO3-shCtr NB8/FOXO3-shSESN3 NB4/FOXO3-shCtr NB4/FOXO3-shSESN3 untreated Etop untreated Etop 300 untreated Bright field 2h Etop 250 ROS % of untreated Ctr 200 * 150 CM-H 2 XROS 100 50 0 NB4/FOXO3-shCtr NB4/FOXO3-shSESN3 c) NB8 shCtr shFOXO3-17 FOXO3 GAPDH 100 44 % FOXO3/GAPDH

Recommend

Supplemental Material Figure S-1: Diagram of the apparatus used to oxidize elemental sulfur in the

Supplemental Material Figure S-1: Diagram of the apparatus used to oxidize elemental sulfur in the

Supplemental Material Figure S-1: Diagram of the apparatus used to oxidize elemental sulfur in the synthesis of 33 S- 2- from 33 S 0 . SO 4 Figure S-2: Isotope and element ratio properties of the five clusters for the killed control sample showing

432 views • 4 slides
Fukushima et al., Supplemental Figure S1 A Col - 0 +MV0.01 M +MV0.05 M +MV0.1 M MS B

Fukushima et al., Supplemental Figure S1 A Col - 0 +MV0.01 M +MV0.05 M +MV0.1 M MS B

pad2-1 pad2-1 Fukushima et al., Supplemental Figure S1 A Col - 0 +MV0.01 M +MV0.05 M +MV0.1 M MS B +MV0.01 M MS pad2-1 Col - 0 +MV0.05 M +MV0.03 M Fukushima et al., Supplemental Figure S2 1) Control (no-stress) Col-0

135 views • 12 slides
1 Figure 1. Figure 2. 2 Figure 3. Figure 4. 3 Figure 5. Figure 6. 4 Figure 7. Figure 8.

1 Figure 1. Figure 2. 2 Figure 3. Figure 4. 3 Figure 5. Figure 6. 4 Figure 7. Figure 8.

Log onto a dating website and find love! Make sure your face shows your true feelings. Youre being watched StoryFace (http://www.storyface.space/, see figure 1) is a digital creation based on the capture and recognition of facial emotions.

342 views • 5 slides
Supplemental Figure 1. A nucleo5de sequence list comparing

Supplemental Figure 1. A nucleo5de sequence list comparing

MSD and N-terminal Sequences EboGP Q G D N D N W W T G W R Q W I P A G I G V T G V V I A V I A L F C I C K F V F P 1912 CAGGGGGACAATGACAATTG GTGGACAGGATGGAGACAAT GGATACCGGCAGGTATTGGA

439 views • 5 slides
2018 Employer Health Benefits Survey Release Slides October 3, 2018 Figure 1 Figure 2 Figure

2018 Employer Health Benefits Survey Release Slides October 3, 2018 Figure 1 Figure 2 Figure

2018 Employer Health Benefits Survey Release Slides October 3, 2018 Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 19 Figure 12 Figure 22 Figure 13 Figure 14 Figure 15

484 views • 29 slides
1*1 Figure 1. Original Figure 2. After Figure 3. After Figure 4. After fog_ image first

1*1 Figure 1. Original Figure 2. After Figure 3. After Figure 4. After fog_ image first

BLACK AND WHITE POSITIVE SLIDES George Agius/Frank Ventura Photography was always a popular camera. In other words there is no pastime, and with the ever increasing need to develop a negative and then availability of cameras, films and reexpose

233 views • 4 slides
Figure 1: Team Logo 2 Figure 2: AISC SSBC Event Logo [1] Figure 3: Vertical Load locations [1]

Figure 1: Team Logo 2 Figure 2: AISC SSBC Event Logo [1] Figure 3: Vertical Load locations [1]

Figure 1: Team Logo 2 Figure 2: AISC SSBC Event Logo [1] Figure 3: Vertical Load locations [1] Table 1: Load combinations [1] 3 Figure 4: Construction Site Plan for Competition [1] 4 5 1 2 6 3 7 4 8 Figure 5: Preliminary Deck Trusses

256 views • 25 slides
Figure 1c Figure 1d Figure 1g Figure 1f Supplementary Figure 1c Supplementary Figure 1g

Figure 1c Figure 1d Figure 1g Figure 1f Supplementary Figure 1c Supplementary Figure 1g

Figure 1c Figure 1d Figure 1g Figure 1f Supplementary Figure 1c Supplementary Figure 1g Figure 5e, right panels. WT+Rap WT+Rap WT Con WT Con DDX6 ESC #2 DDX6 ESC #2 WT+HBSS WT+HBSS WT+RAP WT+RAP Actin LC3 WT Con WT Con DDX6 ESC #2

281 views • 10 slides
Figure 2 . Figure 3 . Figure 4 US Nuclear Industry Is Achieving Record Levels of Performance

Figure 2 . Figure 3 . Figure 4 US Nuclear Industry Is Achieving Record Levels of Performance

Figure 2 . Figure 3 . Figure 4 US Nuclear Industry Is Achieving Record Levels of Performance (1980-2000) 90 89.6 85 Capacity Factor (%) 80 75 70 65 60 55 80 82 84 86 88 90 92 94 96 98 2000 All 103 Units Figure 5 THE

489 views • 10 slides
1 Functional group classifications Chapter 2 - Alkanes Classification of hydrocarbons: aliphatic

1 Functional group classifications Chapter 2 - Alkanes Classification of hydrocarbons: aliphatic

Atoms of ethylene sp 2 -Hybridization of carbon Figure 1.24 Figure 1.25 sp -Hybridization of carbon Acetylene is a linear molecule Figure 1.29 Figure 1.28 HO O H VSEPR - Prediction of molecular geometry CO sp 3 - Tetrahedral geometry, 4

454 views • 3 slides
Figure 4.1 Drawing hands by MC Escher Figure 1.2 The brain viewed from above, with right hemisphere

Figure 4.1 Drawing hands by MC Escher Figure 1.2 The brain viewed from above, with right hemisphere

Figure 4.1 Drawing hands by MC Escher Figure 1.2 The brain viewed from above, with right hemisphere displaced to reveal the corpus callosum Figure 1.1 Embryonic origins of the cerebral hemispheres Rolandic fissure (or central sulcus) Sylvian

547 views • 53 slides
Devil Figures What is the devil figure archetype in a story? Definition: The devil figure

Devil Figures What is the devil figure archetype in a story? Definition: The devil figure

Devil Figures What is the devil figure archetype in a story? Definition: The devil figure represents a devil incarnate. They often offer worldly goods, fame, and knowledge in exchange for souls. The figure's main purpose is to distract or

440 views • 15 slides
Figure 1: World prices of coltan and gold Figure 2: Local prices of coltan and gold Figure 6:

Figure 1: World prices of coltan and gold Figure 2: Local prices of coltan and gold Figure 6:

Figure 1: World prices of coltan and gold Figure 2: Local prices of coltan and gold Figure 6: Demand shock for coltan and presence of stationary bandits Notes : This figure plots the average number of stationary bandits on year. I take the

130 views • 9 slides
Plasmids are excellent cloning vectors Figure 5.21 Figure

Plasmids are excellent cloning vectors Figure 5.21 Figure

Plasmids are excellent cloning vectors Figure 5.21 Figure 11.11 Order of restriction enzyme cut sites in polylinker Ampicillin lacZ resistance Apo I - Eco RI Ban II - Sac I Acc 651 - Kpn I Ava

436 views • 21 slides
Supplemental Aids: Whats Allowed and Whats Not? Manual pg. 43 Type 1 2 Supplemental

Supplemental Aids: Whats Allowed and Whats Not? Manual pg. 43 Type 1 2 Supplemental

42 Supplemental Aids: Whats Allowed and Whats Not? Manual pg. 43 Type 1 2 Supplemental Aids The format of the Student Eligibility Criteria was changed for clarification; however, the policy is the same as the previous year.

608 views • 33 slides
Light from the West Figure: The upper limes germanicus , s. ii CE (CC-BY-SA: source) Figure: The

Light from the West Figure: The upper limes germanicus , s. ii CE (CC-BY-SA: source) Figure: The

Light from the West Figure: The upper limes germanicus , s. ii CE (CC-BY-SA: source) Figure: The upper limes germanicus , s. ii CE (public domain: source) Figure: Invasions of the Roman Empire (CC-BY-SA: source) Figure: A leaf from the Codex

485 views • 27 slides
NO DISCLOSURES 2 1 Supplemental Oxygen Services Today 1.0 1.5 million adults in the US

NO DISCLOSURES 2 1 Supplemental Oxygen Services Today 1.0 1.5 million adults in the US

Supplemental Oxygen and Interstitial Lung Disease status, frustrations, solutions 1 NO DISCLOSURES 2 1 Supplemental Oxygen Services Today 1.0 1.5 million adults in the US use supplemental oxygen majority Medicare beneficiaries

292 views • 17 slides
ADWR Supplemental Funding Strategy Supplemental Funding Goal of full cost recovery for

ADWR Supplemental Funding Strategy Supplemental Funding Goal of full cost recovery for

ADWR Supplemental Funding Strategy Supplemental Funding Goal of full cost recovery for permitting/ licensing programs Assumes a continuing General Fund appropriation for other agency activities Todays Topics Amended SB1359

446 views • 23 slides
Determinism and Volition in Antiquity Figure: Unsourceable Internet image Free Will? Figure: The

Determinism and Volition in Antiquity Figure: Unsourceable Internet image Free Will? Figure: The

Determinism and Volition in Antiquity Figure: Unsourceable Internet image Free Will? Figure: The Matrix (YouTube link) Figure: Oliver Sacks (YouTube link) mere appearance Leucippus and Democritus: Atomism (See Edmunds, Necessity, Chance,

217 views • 17 slides
Supplemental Payments: Hot T opic for Hospitals and Nursing Facilities Leah Mannweiler, Esq.

Supplemental Payments: Hot T opic for Hospitals and Nursing Facilities Leah Mannweiler, Esq.

2016 Indiana HFMA Spring Institute Supplemental Payments: Hot T opic for Hospitals and Nursing Facilities Leah Mannweiler, Esq. Meghan Linvill McNab, CPA, Esq. 1 SUPPLEMENTAL PAYMENTS HISTORY 2 Supplemental Payments and the UPL Upper

296 views • 26 slides
Signal Theory Figure 2.1: The four-universe paradigm. Figure 2.2: Levels of abstraction in signal

Signal Theory Figure 2.1: The four-universe paradigm. Figure 2.2: Levels of abstraction in signal

Chapter 2 Signal Theory Figure 2.1: The four-universe paradigm. Figure 2.2: Levels of abstraction in signal representation. 1 2 CHAPTER 2. SIGNAL THEORY Figure 2.3: The -neighborhood in the uniform metric. Figure 2.4: Sampling and

323 views • 13 slides
Figure 1. Location map showing the Holbrook Basin in eastern Arizona. Figure 2. Map of northern

Figure 1. Location map showing the Holbrook Basin in eastern Arizona. Figure 2. Map of northern

Figure 1. Location map showing the Holbrook Basin in eastern Arizona. Figure 2. Map of northern and central Arizona showing the general location of the Rocking Chair Ranch No. 4 well, Section 27, T.14N, R.19E. Figure 3. Annotated dual induction

584 views • 26 slides
Statistical Exploration of Climate Data Figures from Module McGuire Air Force Base Figure 1:

Statistical Exploration of Climate Data Figures from Module McGuire Air Force Base Figure 1:

Statistical Exploration of Climate Data Figures from Module McGuire Air Force Base Figure 1: Average Daily Temperature at McGuire AFB Figure 2: 1955 (blue), 2000 (red) Figure 3: Anatomy of a Boxplot Figure 4: Boxplots for Each Year

146 views • 11 slides
Figure PET 1 from page 150 of Exploring the Heart of

Figure PET 1 from page 150 of Exploring the Heart of

Figure PET 1 from page 150 of Exploring the Heart of Ma2er e e + 18 F 18 O FIGURE PET 1 Illustration of positron decay. One of the protons (red) in the unstable nucleus is converted into a

159 views • 3 slides

More recommend