Probe systems and mastermixes in real-time PCR allowing mismatch - PowerPoint PPT Presentation

Probe systems and mastermixes in real-time PCR allowing mismatch tolerance and mismatch discrimination Suzan D. Pas 1 1 Viroscience lab, Erasmus MC, Rotterdam, the Netherlands 2 Affiliations

Taqman or hydrolysis probe mismatches Denaturation Primer and Probe Hybridization, 90-95 ° C Extension Cleavage & detection TaqMan Assay 60-62 ° C Taqman probes in general have a Tm of ± 69 ° C therefore allowing 2-3 mismatches

Guidelines real time PCR design (I)  Amplicons:  · select the probe first and design the primers as close as possible to the probe without overlapping it. Amplicons of 50 to 150 bp are strongly recommended. · GC content within 30-80% · avoid homopolymers, this is especially true for guanine, where runs of four or more Gs should be avoided  General Taqman Probes: · Tm should be within 68 ° C to 70 ° C · no Gs on the 5’ end · select the strand that gives the probe more C than G bases

Guidelines real time PCR design (II)  Primers: · Tm should be within 58 ° C to 60 ° C · the last 5 bases at the 3 prime end should have no more than two G's or C's  · ideally there are no mismatches in the last 5 nt at the 3’side · keep the annealing Tm of the primers as close as possible · select primer pairs with minimal number of potential primer dimers and primer hairpins as possible

Hybridization temperature T m = 81.5 ° C + 16.6 ° C x (log 10 [Na + ] + [K + ]) + 0.41 ° C x (%GC) – 675/N Length 27 nt tgggaggttctctccagcactagcagg GC content 60% Tm 69 ºC tgggaggttctctccagcactagcagg Tm 62.6 ºC a t tgggaggttctctccagcactagcagg Tm 57.8 ºC a t a For calculation of Tm and impact of mismatches on Tm http://eu.idtdna.com/analyzer/Applications/OligoAnalyzer/

HIV-1 group M sequence variation in Gag and Pol genes

Novel probe technology: Partially double stranded linear DNA probes R R Q Q – Long target-specific probe with fluor – Short quencher probe – Fluorescence quenched when probes are hybridized – Long probe preferentially binds target – Short quencher probe is dissociated – Fluorescence is detected Excitation Excitation Emission Emission R

Uncoupling of Detection and Extension Step Key to Increased Mismatch Tolerance Abbott Abbott RealTi RealTi m m e e HIV HIV - - 1 1 Denaturation Denaturation Extension, Probe Hybridization, Extension, Probe Hybridization, 95 ° C 90 - 95 ° C Cleavage & detection Cleavage TaqMan TaqMan 50 60 - 60 ° C ° C Assay Assay

Mismatch tolerance of partially double stranded probes R Q Target transcripts: 1 wt 16 mutant (2-6 mm) Luk et al. J Virol Methods 144;2007,1-11

Impact of the length of target specific probe (P) on mismatch tolerance Impact of the length of quencher probe (Q) on mismatch tolerance Meltcurve analysis Luk et al. J Virol Methods 144;2007,1-11

Partially Double-Stranded linear Probe P45/Q11: High mismatch tolerance (mm) (log 10 ) (mm) (log 10 ) (mm) (log 10 ) 0 0 0 4.7 4.7 4.7 4 4 4 4.6 4.6 4.6 4 4 4 4.6 4.6 4.6 2 2 2 4.7 4.7 4.7 5 5 5 4.7 4.7 4.7 5 5 5 4.5 4.5 4.5 2 2 2 4.7 4.7 4.7 3 3 3 4.7 4.7 4.7 5 5 5 4.2 4.2 4.2 3 3 3 4.6 4.6 4.6 4 4 4 4.5 4.5 4.5 5 5 5 4.5 4.5 4.5 4 4 4 4.5 4.5 4.5 5 5 5 4.5 4.5 4.5 6 6 6 4.3 4.3 4.3 4 4 4 4.6 4.6 4.6 3 3 3 4.8 4.8 4.8 High sensitivity and specificity with exceptional tolerance to nucleotide mismatches. Ideal for homogeneous detection of polymorphic targets.

Partially Double-Stranded Linear Probe Design F Q Mismatches Discriminate OR Tolerate Quencher Conc High Low Quencher T m High Low Target specific Probe T m Low High Detection Temperature High Low

Assays for the detection of single mutations  Conventional Sanger sequencing: ~25-50%  Sensitive methods:  LIPA/DNA microarray 5-10%  LigAmp 0.01-0.1%  454 sequencing 0.5-1%  Digital PCR <0.001 - 10%  Quantitative real-time techniques: 1-10%  LNA/MGB probes (short high affinity probes)  Molecular beacons  Scorpions

Minor groove binding probes Locked nucleic acid probes • Due to higher affinity binding shorter probes can be defined • Taqman probes are 24-29 nt long • LNA/MGB probes 14-19 nt long

Hybridization temperature: effect in MGB and LNA probes T m = 81.5 ° C + 16.6 ° C x (log 10 [Na + ] + [K + ]) + 0.41 ° C x (%GC) – 675/N Length 27 nt tgggaggttctctccagcactagcagg GC content 60% Tm 69 ºC tgggaggttctctccagcactagcagg Tm 62.6 ºC a t tgggaggttctctccagcactagcagg Tm 57.8 ºC a t a Length 17 nt GGAGG(+T)T(+C)TCT(+C)CAG(+C)A GC content 59% Tm 69 ºC Tm 59 ºC GGAGG(+T)T(+C)TCT(+C)CAG(+C)A A

Detection of oseltamivir resistant influenza A/H1N1 H274Y by real-time discrimination PCR using LNA probes H/Y-PCR target T (mut) NA: 5’atcgaaaagggaaaggttactaaatcaatagagttaaatgcacccaatttt C attatgaggaatgttcctgttacccagacactggc 3’ LNA:H274Y N1274Yfpr1 N1274Yrpr1 (30bp) (24bp) LNA:H274H (16bp) DFO Mutant cluster + control + control FAM Wild-type cluster + control + control NTC NTC Erhard van der Vries et al., ESCV 2009

Molecular Beacons: mode of action NASBA/PCR NASBA/PCR A T C A T C A T C A T C A T C A T C RNA RNA or or DNA DNA T T T C C C G G G C C C T T T A A A C G T T T C A T A G T A G G G A G G T A C G T T T C A T A G T A G G G A G G T A C G T T T C A T A G T A G G G A G G T A C C C A A A G C A A A G T A T C A T C C C T C C A G G C A A A G T A T C A T C C C T C C A G A A A C C C C C C C G G G G C C C A A A G G G G C C C C G G G G G G C C C G G G A A A A T T T T G G G C C C A A A A T T T T C C C C A T A T A T G G G G C C C C A A A T T T G G G G F F C C C G G G Q Q C C C G G G F F Q Q Molecular beacon DNA probe

Mutation discrimination with molecular beacons YMDD (atg) x YIDD (att) x YSDD (atg) no template temperature 85 °C 25 °C Pas et al., Journal of Clinical Virology 32 (2005) 166 – 172

Pas et al., Journal of Clinical Virology 32 (2005) 166 – 172

Influence of mastermix composition on primer bindingsite mismatch tolerance

Influence of mismatches in the primer binding site on Real-time (RT-)PCR efficiency > 100 fold under estimation!! Low impact, combined mismatches at 3’ end No amplification!! <100 fold >10 and <10 fold

Preventing underquantification due to mutations in primers and probes  Avoid mutations in the last 5 nucleotides of the 3‘ part of the primers  Avoid C-C!!, A-A, G-G, G-A en A-G  Avoid mutations in the last nucleotide at the 3‘ part of the primers  Avoid T-C, C-T en T-T  A-C, C-A, T-G en G-T mismatches are relatively well tolerated

Influence of mastermix composition on mismatch tolerance in the primer regions MMLV / Taqgold combination (ABI): RT @ 48°C

Influence of mastermix composition on mismatch tolerance in the primer regions rTTH based mastermix: RT@60°C

Mismatch effects at 3’ -end position : DNA and RNA compared DNA: Taq gold polymerase RNA: MMLV / Taq gold polymerase Denaturation Denaturation Extension, Probe Hybridization, Extension, Probe Hybridization, 95 ° C 90 - 95 ° C Cleavage & Read Cleavage & Read Reverse 50 60 - 60 ° C ° C transcription 48 °C

Conclusions Mismatch tolerance: • Highly polymorphic target at rev primer  use MMLV/Taqgold • Highly polymorphic target at fwd primer  use rTth based mastermix  With highly variable targets like viruses, bacteria and variable regions within eukaryotic genomes special attention should be paid to probe design and mastermix composition (rTtH versus Taq as polymerase, Glycerol/MgCl2/dNTP/ concentrations)

Variant detection techniques Sanger sequencing 25-50% Lipa 10% HBV Replication Allele specific PCR 1-5% NGS 0.5% Time Fung, Antivir Ther 2004; Locarnini, Antivir Ther 2004