Genotyping near full-length hepatitis C viruses Snoeck Joke Rega - PowerPoint PPT Presentation

Genotyping near full-length hepatitis C viruses Snoeck Joke Rega Institute for Medical Research, KU Leuven, Leuven, Belgium AREVIR Meeting 2010 J. Snoeck – April 22th

Introduction AREVIR Meeting 2010 J. Snoeck – April 22th

Hepatitis C Virus Anzola et al., Expert Reviews in Molecular Medicine, 2003 AREVIR Meeting 2010 J. Snoeck – April 22th

HCV replication cycle • (a) binding and internalisation • (b) cytoplasmic release and uncoating • (c) translation and polyprotein processing • (d) RNA replication • (e) assembly • (f) maturation and release Moradpour et al., Nature Reviews 2007 AREVIR Meeting 2010 J. Snoeck – April 22th

HCV drugs • (a) entry inhibitor • (b) • (c) protease inhibitor • (d) polymerase inhibitor • cyclophilin inhibitor • (e) glucosidase inhibitor • (f) • New interferons, p7 inhibitors, host factor inhibitors, immunomodulators, ….. Moradpour et al., Nature Reviews 2007 AREVIR Meeting 2010 J. Snoeck – April 22th

HCV diversity • 6 genotypes, more than 70 subtypes • 30-35% between genotypes on nuc. level • 20-25% between subtypes on nuc. level • In the patient : quasispecies Selective pressure Irshad , Reviews in Medical Virology, 2008 AREVIR Meeting 2010 J. Snoeck – April 22th

Why perform genotyping ? >NS5B CTAaACCTCaaAGAAaAACCAAACGTAATACCAACCGCCGCCCACAGGACGTTAAGTTCCCGGGCGGCGGCCAGATCGT TGGTGGAGTTTACTTGTTGCCGCGCAGGGGCCCCAGGTTGGGTGTGCGCGCGACTAGGAAGACTTCCGAGCGGTCGC AACCTCGTGGAAGGCGACAACCTATCCCCAAGGCTCGCCGGCCCGAGGGCAGGACCTGGGCTCAGCCCGGGTACCCT TGGCCCCTCTATGGCAACGAGGGCATGGGGTGGGCAGGATGGCTCCTGTCACCCCGCGGCTCCCGGCCTAATTGGGG CCCCACAGACCCCCGGCGTAGGTCGCGTAACTTGGGTAAGGTCATCGATACCCTCACATGCGGCTTCGCCGATCTCAT GGGGTACGTTCCGCTCGTCGGTGCCCCCCTAGGGGGCGTTGCCAGGGCCCTGGCGCATGGCGTCCGGACTCTGGAG GACGGCGTGAACTATGCAACAGGGAACTTGCCCGGTTGCTCTTTCTCTATCTTCCTCTTGGCTTTGCTGTCCTGTTTGAC CATCCCAGCTTCCGCTTATGAAGTGCGCAACGTGTCCGGGGTGTACCATGTCACGAACGACTGCTCCAACTCAAGCATT GTGTATGAGGCAGCGGACATGATCATGCACACCCCCGGGTGCGTGCCCTGCGTTCGGGAAGCCAACTCCTCCCGCTG CTGGGTAGCGCTCACCCCTACGCTTGCGGCCAGGAACGCTAGTGTCCCCACCGTGACAATACGACGCCATGTCGATTT AREVIR Meeting 2010 J. Snoeck – April 22th

Method AREVIR Meeting 2010 J. Snoeck – April 22th

General method (1) RNA extraction (Qiagen viral RNA extraction) cDNA synthesis (Expand RT from Roche) PCR amplification (Expand High Fidelity from Roche) Capillary sequencing AREVIR Meeting 2010 J. Snoeck – April 22th

General method (2) cDNA synthesis from NS2 cDNA synthesis from NS5A cDNA synthesis from 3’UTR 5’UTR-NS2 outer PCR E2-NS5A outer PCR 5’UTR-NS2 inner PCR NS4B-NS5B outer PCR E2-NS5A inner PCR NS4B-NS5B inner PCR AREVIR Meeting 2010 J. Snoeck – April 22th

Results AREVIR Meeting 2010 J. Snoeck – April 22th

Validation of the assay (1) Mean detection limit based on a dilution series of 10 samples Partial PCR HCV1a HCV1b 1st (5'UTR-NS2) 935 (170-1700) 1700 (170-1700) 2nd (E2-NS5A) 1700 (170-17000) 1700 (1700-17000) 3rd (NS4B-NS5B) 1700 (170-170000) 17000 (1700-170000) Reproducibility based 50 (1a) or 35 (1b) samples tested in triplicate HCV1a 1 HCV1b 2 # postitive PCRs 3 1st (5'UTR-NS2) 2nd (E2-NS5A) 3rd (NS4B-NS5B) 1st (5'UTR-NS2) 2nd (E2-NS5A) 3rd (NS4B-NS5B) 0 positive 0 (0%) 0 (0%) 2 (6%) 0 (0%) 2 (4%) 2 (4%) 1 positive 0 (0%) 1 (3%) 2 (6%) 2 (4%) 5 (10%) 7 (14%) 2 positive 1 (3%) 1 (3%) 3 (8%) 17 (34%) 23 (46%) 17 (34%) 3 positive 34 (97%) 33 (94%) 28 (80%) 31 (62%) 20 (40%) 24 (48%) Performance of the sequencing primers : • HCV1a succes rate between 70-100% • HCV1b succes rate between 80-100% AREVIR Meeting 2010 J. Snoeck – April 22th

Validation of the assay (2) G G e e n n o o G t t G y y Genotype 4 e e p p n n e e o o 3 t 2 t y y p p e e 6 5 0.05 G e n o t y p AREVIR Meeting 2010 J. Snoeck – April 22th e 1 c

Data interpretation • Genotyping data allows us to – Study appearance of drug resistance-related variants under drug selective pressure – Study evolution of the virus under drug/immune/… selective pressure – Study epidemiology of the virus – Study the mode of action of new anti-HCV drugs – … • Full genome information allows us to : – Study the mode of action of new anti-HCV drugs – Study mutations in different genes at the same time – … AREVIR Meeting 2010 J. Snoeck – April 22th

Discussion AREVIR Meeting 2010 J. Snoeck – April 22th

Is full genome data needed for drug resistance screening ? • Is there a clear relationship between the protein targetted by the administrated drug and the appearance of mutations in the gene coding for the targetted protein ? – On first sight : YES – Upon closer examination : not necessarily Active site: binding site for inhibitor and natural substrate Protease Substrate can still bind Inhibitor cannot bind  reduced function  resistant protease AREVIR Meeting 2010 J. Snoeck – April 22th

Interferon - ribavirin Core and NS5A Fukuhara et al. , Journal of Hepatology 2010 E2 NS4B Taylor et al. , Science 1999 Yi et al. , Virus Research 2009 AREVIR Meeting 2010 J. Snoeck – April 22th

Protease inhibitors Sarazin and Zeuzem , Gastroenterology 2010 AREVIR Meeting 2010 J. Snoeck – April 22th Moradpour et al., Nature Reviews 2007

Polymerase inhibitors Sarazin and Zeuzem , Gastroenterology 2010 Moriishi et al., Reviews in Medical Virology 2007 AREVIR Meeting 2010 J. Snoeck – April 22th

Cyclophilin inhibitors In vitro resistance-related mutations Puyang et al. , Antimicrobial Agents and chemotherapy 2010 AREVIR Meeting 2010 J. Snoeck – April 22th

Is full genome feasible in a clinical setting ? • The assay as it is, is quite expensive – about 100 euro material to amplify the 3 parts of the genome – on average (depending on the genotype) 40 sequencing primers, 5 euro per reaction = 200 euro for sequencing (by a commercial company)  300 euro per patient sample without the personnel cost • Personnel cost – Amplifying the genome does not take that much time, but the analysis of the sequencing results is quite labour-intensive !  Best seems to stick to what we know at the moment AREVIR Meeting 2010 J. Snoeck – April 22th

Conclusions and future perspectives AREVIR Meeting 2010 J. Snoeck – April 22th

Conclusion (1) • We describe a near-full length genotypic assay for HCV genotypes 1a and 1b , based on PCR amplification and capillary sequencing. • The sensitivity for both the assays is good for the 5’UTR-NS2 and NS2-NS5A region, 1700 viral copies/ml or lower. The detection limit for the NS4B-3’UTR region for both assays was less. Such a sensitivity is sufficient to investigate the in vivo mode of action of new anti- HCV drugs, and the method can be used to monitor HCV therapy response . • The sets of sequencing primers that we designed are able to sequence the near-full length genome of HCV1a and 1b strains in both directions . This enables us to reliably detect quasispecies and use the assay for determining genotypic drug resistance in patient strains. AREVIR Meeting 2010 J. Snoeck – April 22th

Conclusion (2) • Routine full genome sequencing does not seem feasible at the moment, it is a good idea though for research questions  determine the gene(s) that needs to be sequenced to study resistance towards a particular drug • For the moment, stick to what is known : clear relationships between the appearance of mutations and the susceptibility of the virus to the antiviral, for example – Polymerase inhibitors  NS5B – Protease inhibitors  NS3 AREVIR Meeting 2010 J. Snoeck – April 22th

Future perspectives • Expand the assay to other genotypes, using the same strategy • Upscale the assay to a more high throughput assay • Reduce the time of the assay (faster enzymes, methods, …) • Explore the use of next-generation sequencing – Go deeper than 25% detection of quasispecies – Easier analysis of sequencing data if there is adequate software available – Faster : pool samples using barcoding AREVIR Meeting 2010 J. Snoeck – April 22th

Acknowledgments • Prof. Anne-Mieke Vandamme and Lien Kerremans from the Rega Institute for Medical Research, KULeuven, Belgium Rega Institute for Medical Research AREVIR Meeting 2010 J. Snoeck – April 22th