From yesterday to tomorrow: past, present and future of sequencing - PowerPoint PPT Presentation

From yesterday to tomorrow: past, present and future of sequencing The NGS revolu-on Laurent FARINELLI 19 October 2017 ICCMg2 Second Interna<onal Conference on Clinical Metagenomics Geneva, Switzerland www.fasteris.com

Be at the right place and =me 1996 Streptococcus pneumoniae GlaxoWellcome Geneva Biomedical Research Ins<tute Jonathan Knowles: Have fun in you work “The right drug for the right pa@ent” 7 instruments ABI 377 www.fasteris.com 19 October 2017 Second Interna-onal Conference on Clinical Metagenomics (c) 2017, Fasteris SA 2

Bead Arrays September: I was asked, with Pascal Mayer, to develop faster sequencing October: Heard of Bead Arrays: brilliant, but too complicated Lynx Therapeu-cs’ MegaClone Massively Parallel Signature Sequencing ( MPSS ) Gene Expression Profiling Brenner, S . et al. , Nature Biotechnology 18 :630-634 (2000) www.fasteris.com 19 October 2017 Second Interna-onal Conference on Clinical Metagenomics (c) 2017, Fasteris SA 3

Inven=on of PCR Colonies 13 November 1996: Inven-on of PCR Colonies and base-by-base sequencing www.fasteris.com 19 October 2017 Second Interna-onal Conference on Clinical Metagenomics (c) 2017, Fasteris SA 4

A special day 13 November 1996 : Inven-on of PCR Colonies and step-by-step sequencing www.fasteris.com 19 October 2017 Second Interna-onal Conference on Clinical Metagenomics (c) 2017, Fasteris SA 5

Two patents filed By X’Mas: Proof-of-principles 1 April 1997: Two Patents filed www.fasteris.com 19 October 2017 Second Interna-onal Conference on Clinical Metagenomics (c) 2017, Fasteris SA 6

PCR Colonies project 1996-1997 GlaxoWellcome 1998-2000 Serono 2001-2003 GenInEx / Manteia Predic=ve Medicine With your genome on CD you consult our database to predict response to treatment or risk of disease Library prepara-on, including Y-shaped adapter (Laurent) and P5, P7 (Magne) Instrument (Microscope and flow-cell) A T T A Reverse terminator sequencing chemistry Sodware for real--me DNA colonies detec-on and base-calling 2004-2006 Solexa & Lynx Therapeu-cs ($4 M) 2007- illumina ($600 M) www.fasteris.com 19 October 2017 Second Interna-onal Conference on Clinical Metagenomics (c) 2017, Fasteris SA 7

2003, Fasteris Everything started in a chalet... www.fasteris.com 19 October 2017 Second Interna-onal Conference on Clinical Metagenomics (c) 2017, Fasteris SA 8

NGS Pioneers Solexa Cluster Station Solexa Genome Analyzer Library Preparation Kit Data analysis www.fasteris.com 19 October 2017 Second Interna-onal Conference on Clinical Metagenomics (c) 2017, Fasteris SA 9

2007 installa=on run Staphylococcus aureus for HUG Genomic Laboratory 8 lanes of 500’000 reads of 26 bases Difficult to analyze data: I had to use mySQL database to sort reads I could easier assemble genomes using EDENA than map on reference Plasmid NOT included in the reference sequence => artefact and false SNPs www.fasteris.com 19 October 2017 Second Interna-onal Conference on Clinical Metagenomics (c) 2017, Fasteris SA 10

NGS Pioneers We developed: Genomes Microsporidia de novo assembly 800 700 of transcriptome Number of Mapped Reads 600 500 400 ChIP-SEQ 300 200 100 0 Bar-coded small RNAs 0 5000000 10000000 15000000 20000000 25000000 Position on the Reference Sequence At the end of 2007, proud to be considered by illumina First service lab to buy the machine Smallest lab to use the technology The lab that developed the broadest range of applica-ons www.fasteris.com 19 October 2017 Second Interna-onal Conference on Clinical Metagenomics (c) 2017, Fasteris SA 11

Today applica=ons Medical diagnos-cs Under Swiss law for gene-cs Bestsellers Batches every 1-2 weeks Stable protocols, short TAT, lower cost, higher volumes Personalized 1-2 batch per month Many op-ons, partnership with researchers Research Developing new protocols www.fasteris.com 19 October 2017 Second Interna-onal Conference on Clinical Metagenomics (c) 2017, Fasteris SA 12

Medical applica=ons Non-invasive prenatal test (NIPT) 2013: Whole genome 2015: Reimbursed T13, 18, 21 Soma-c Cancer Panels Germline Cancer Panels Preimplanta-on Diagnos-c (PGD-A) 2017: Fasteris accredita-on and gene-cs authoriza-on www.fasteris.com 19 October 2017 Second Interna-onal Conference on Clinical Metagenomics (c) 2017, Fasteris SA 13

Bestsellers applica=ons Genomes Exomes Transcriptomes Small RNA www.fasteris.com 19 October 2017 Second Interna-onal Conference on Clinical Metagenomics (c) 2017, Fasteris SA 14

Personalized applica=ons Many different protocols Several op-ons, e.g. Ribozero to eliminate host and bacterial rRNA MetaFAST Research Custom protocols www.fasteris.com 19 October 2017 Second Interna-onal Conference on Clinical Metagenomics (c) 2017, Fasteris SA 15

2008 NGS Metagenomics First metagenomics paper using illumina NGS? Genomic Research Laboratory University Hospital of Geneva Oral samples, amplicons of the 16S rRNA V5 variable region www.fasteris.com 25 January 2017 Laurent Farinelli – Université Paris Descartes (c) 2017, Fasteris SA 16

Clinical Metagenomics Collabora=on with Impact on survival ader cys-c fibrosis lung transplant Looking for viruses in glioblastoma Shotgun approach to find viruses and fungi Collabora=on with www.fasteris.com 19 October 2017 Second Interna-onal Conference on Clinical Metagenomics (c) 2017, Fasteris SA 17

Metagenomics protocols 16S Metagenomic Sequencing Library Preparation Preparing 16S Ribosomal RNA Gene Amplicons for the Illumina MiSeq System 1-step PCR Introduction 2 Using primers with long tags (>60 nucleo-des) 16S Library Preparation Workflow 5 Amplicon PCR 6 Advantage: - Add the en-re illumina adapter sequence PCR Clean‐Up 8 Index PCR 10 Introduction PCR Clean‐Up 2 13 Page 3 in one step. [Optional] Validate Library 15 Library Quantification, Normalization, and Pooling 16 Figure 1 16S V3 and V4 Amplicon Workflow Library Denaturing and MiSeq Sample Loading 17 Inconvenient: - Long primers MiSeq Reporter Metagenomics Workflow 20 Supporting Information 21 Expensive and significant impact on amplifica-on efficiency 2-steps PCR 1 st step with primers with medium tag (30 nt) 2 nd step with illumina primers Advantage: - Only one primer pair needed for 1 st step. Inconvenient: - 2 PCR reac-ons needed User‐defined forward and reverse primers that are complementary upstream and downstream of the region of interest are designed with overhang adapters, and used to amplify templates from genomic IMPORTANT This document provides information for an application for Illumina technology that has DNA. A subsequent limited‐cycle amplification step is performed to add multiplexing indices and been demonstrated internally and may be of interest to customers. This information is NOTICE Illumina sequencing adapters. Libraries are normalized and pooled, and sequenced on the MiSeq provided as‐is and is not an Illumina product and is not accompanied by any rights or warranties. Customers using or adapting this information should obtain any licenses system using v3 reagents. required and materials from authorized vendors. Illumina products mentioned herein are Libraries with low complexity for research use only unless marked otherwise. While customer feedback is welcomed, this Amplicon Primers application is not supported by Illumina Technical Support and Field Application Scientists. All inserts in the same orienta-on with similar sequences • The gene‐specific sequences used in this protocol target the 16S V3 and V4 region. They are selected from the Klindworth et al. publication (Klindworth A, Pruesse E, Schweer T, Part # 15044223 Rev. B Page 1 Peplles J, Quast C, et al. (2013) Evaluation of general 16S ribosomal RNA gene PCR => Impact on sequence quality primers for classical and next‐generation sequencing‐based diversity studies. Nucleic Acids Res 41(1).) as the most promising bacterial primer pair. Illumina adapter overhang nucleotide sequences are added to the gene‐specific sequences. The full length www.fasteris.com primer sequences, using standard IUPAC nucleotide nomenclature, to follow the protocol 19 October 2017 Second Interna-onal Conference on Clinical Metagenomics (c) 2017, Fasteris SA 18 targeting this region are: 16S Amplicon PCR Forward Primer = 5' TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG 16S Amplicon PCR Reverse Primer = 5' GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC • This method can also be utilized to target other regions on the genome (either for 16S with other sets of primer pairs, or non‐16S regions throughout the genome; ie any amplicon). The overhang adapter sequence must be added to the locus‐specific primer for the region to be targeted (Figure 1). The Illumina overhang adapter sequences to be added to locus‐specific sequences are: Forward overhang: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG‐[locus‐ specific sequence] Reverse overhang: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG‐[locus‐ specific sequence]