Diversity and Plasticity of RNA Beyond the One-Sequence-One-Structure Paradigm Peter Schuster Institut für Theoretische Chemie und Molekulare Strukturbiologie der Universität Wien Chemistry towards Biology Portorož, 8.– 12.09.2002
5' - end N 1 O The chemical formula of RNA CH 2 O consisting of nucleobases, ribose rings, phosphate groups, and sodium counterions N A U G C k = , , , OH O N 2 CH 2 O P O O Na � Magnesium ions play a special O role and act as coordination O OH centers which are indispensible for the formation of full three- N 3 O P O CH 2 dimensional structures O Na � O O OH N 4 O P O CH 2 O Na � O O OH 3' - end O P O Na � O
5'-End 3'-End GCGGAU UUA GCUC AGDDGGGA GAGC CCAGA M CUGAAYA UCUGG AGMUC CUGUG TPCGAUC CACAG A AUUCGC ACCA Biochemical and Crystallography chemical probing NMR, FRET, ...... Structure prediction 3'-End 3'-End 5'-End 70 5'-End 60 10 50 20 30 40 The one sequence – one structure paradigm
One day, when biomolecular structures were understood in sufficient detail, we would be able to design molecules with predefined structures and for a priori given purposes. Biomolecular structures are not fully understood yet, but the lack of knowledge in structure and function can be compensated by applying selection methods.
A A A A A G G C C G G G U U U G C U C C U C G U G C C -3’ 5’- = adenylate A 27 16 � 4 = 1.801 10 possible different sequences = uridylate U = cytidylate C Combinatorial diversity of sequences: N = 4 � = guanylate G Number of (different) sequences created by common scale random synthesis: 10 15 – 10 16 . Combinatorial diversity of heteropolymers illustrated by means of an RNA aptamer that binds to the antibiotic tobramycin
Taming of sequence diversity through selection and evolutionary design of RNA molecules D.B.Bartel, J.W.Szostak, In vitro selection of RNA molecules that bind specific ligands . Nature 346 (1990), 818-822 C.Tuerk, L.Gold, SELEX - Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase . Science 249 (1990), 505-510 D.P.Bartel, J.W.Szostak, Isolation of new ribozymes from a large pool of random sequences . Science 261 (1993), 1411-1418 R.D.Jenison, S.C.Gill, A.Pardi, B.Poliski, High-resolution molecular discrimination by RNA . Science 263 (1994), 1425-1429
Amplification Diversification Genetic Diversity Selection Cycle Selection Desired Properties ? ? ? no Selection cycle used in yes applied molecular evolution to design molecules with predefined properties
Retention of binders Elution of binders n m u l o c c i h p a r g o t a m o r h C The SELEX technique for the evolutionary design of aptamers
A A A A A 5’- G G C C G G G U U U G C U C C U C G U G C C -3’ U U A C A 5’- G G C G G G U A G 3’- C C G U A G C U C C A U C Formation of secondary structure of the tobramycin binding RNA aptamer L. Jiang, A. K. Suri, R. Fiala, D. J. Patel, Chemistry & Biology 4 :35-50 (1997)
The three-dimensional structure of the tobramycin aptamer complex L. Jiang, A. K. Suri, R. Fiala, D. J. Patel, Chemistry & Biology 4 :35-50 (1997)
Mapping RNA sequences onto RNA structures The attempt to investigate this mapping is understood as a search for the relations between all possible 4 n sequences and all thermodynamically stable structures, which are the structures of minimal free energy. Sequence-structure mappings of RNA molecules were studied by a variety of different experimental and in silico techniques.
5'-End 3'-End Sequence GCGGAU UUA GCUC AGDDGGGA GAGC M CCAGA CUGAAYA UCUGG AGMUC CUGUG TPCGAUC CACAG A AUUCGC ACCA 3'-End 5'-End 70 60 Secondary structure 10 Tertiary structure 50 20 30 40 5'-End 3'-End Symbolic notation What is an RNA structure? The secondary structure is a listing of base pairs, and it is understood in contrast to the full 3D-structure dealing with atomic coordinates. An intermediate state of structural details is provided by RNA threading or other toy models.
RNA Secondary Structures and their Properties RNA secondary structures are listings of Watson-Crick and GU wobble base pairs, which are free of knots and pseudokots. Secondary structures are folding intermediates in the formation of full three-dimensional structures. D.Thirumalai, N.Lee, S.A.Woodson, and D.K.Klimov. Annu.Rev.Phys.Chem . 52 :751-762 (2001)
RNA Minimum Free Energy Structures Efficient algorithms based on dynamical programming are available for computation of secondary structures for given sequences. Inverse folding algorithms compute sequences for given secondary structures. M.Zuker and P.Stiegler. Nucleic Acids Res . 9 :133-148 (1981) Vienna RNA Package : http:www.tbi.univie.ac.at (includes inverse folding, suboptimal structures, kinetic folding, etc.) I.L.Hofacker, W. Fontana, P.F.Stadler, L.S.Bonhoeffer, M.Tacker, and P. Schuster. Mh.Chem . 125 :167-188 (1994)
Criterion of Minimum Free Energy UUUAGCCAGCGCGAGUCGUGCGGACGGGGUUAUCUCUGUCGGGCUAGGGCGC GUGAGCGCGGGGCACAGUUUCUCAAGGAUGUAAGUUUUUGCCGUUUAUCUGG UUAGCGAGAGAGGAGGCUUCUAGACCCAGCUCUCUGGGUCGUUGCUGAUGCG CAUUGGUGCUAAUGAUAUUAGGGCUGUAUUCCUGUAUAGCGAUCAGUGUCCG GUAGGCCCUCUUGACAUAAGAUUUUUCCAAUGGUGGGAGAUGGCCAUUGCAG Sequence Space Shape Space Many sequences from the same minimum free energy secondary structure
ψ Sk = ( ) I. fk = ( f Sk ) Non-negative Sequence space Phenotype space numbers Mapping from sequence space into phenotype space and into fitness values
ψ Sk = ( ) I. fk = ( f Sk ) Non-negative Sequence space Phenotype space numbers
ψ Sk = ( ) I. fk = ( f Sk ) Non-negative Sequence space Phenotype space numbers
A connected neutral network
Giant Component A multi-component neutral network
� � � � T = 0 K , t T > 0 K , t T > 0 K , t finite 3.30 3.40 3.10 49 48 47 46 2.80 45 44 42 43 41 40 38 37 39 36 Free Energy 34 35 33 32 31 29 30 28 27 26 25 2.60 24 23 22 21 20 19 3.10 18 S 10 17 16 15 13 14 12 S 8 3.40 2.90 S 9 11 10 9 S 7 5.10 S 5 3.00 S 6 8 6 7 5 S 4 4 S 3 3 7.40 S 2 2 5.90 S 1 S 0 S 0 S 1 S 0 Minimum Free Energy Structure Suboptimal Structures Kinetic Structures Different notions of RNA structure including suboptimal conformations
Partition Function of RNA Secondary Structures John S. McCaskill . The equilibrium function and base pair binding probabilities for RNA secondary structure . Biopolymers 29 (1990), 1105-1119 Ivo L. Hofacker, Walter Fontana, Peter F. Stadler, L. Sebastian Bonhoeffer, Manfred Tacker, Peter Schuster. Fast folding and comparison of RNA secondary structures. Monatshefte für Chemie 125 (1994), 167-188
3' 5' Example of a small RNA molecule with two low-lying suboptimal conformations which contribute substantially to the partition function UUGGAGUACACAACCUGUACACUCUUUC Example of a small RNA molecule: n=28
U U G G A G U A C A C A A C C U G U A C A C U C U U U C C U U C U U U C U C A C A U G U C C A A C A C A U G A G G U U U U G G A G U A C A C A A C C U G U A C A C U C U U U C U C C U G G A U U A second suboptimal configuration C G A U ∆ E = 0.55 kcal / mole 0 →2 U A G C U A C C A C A C U U first suboptimal configuration U C ∆ E = 0.50 kcal / mole U → G G A G 0 1 C C U U A A U U G A U A C A C C A C C 3' U U U C U U U G G A G U C 5' C A minimum free energy A configuration U A G C � G = - 5.39 kcal / mole 0 U A C C A A C U U G G A G U A C A C A A C C U G U A C A C U C U U U C „Dot plot“ of the minimum free energy structure ( lower triangle ) and the partition function ( upper triangle ) of a small RNA molecule (n=28) with low energy suboptimal configurations
5'-End 3'-End Sequence GCGGAU UUA GCUC AGDDGGGA GAGC M CCAGA CUGAAYA UCUGG AGMUC CUGUG TPCGAUC CACAG A AUUCGC ACCA 3'-End 5'-End 70 60 Secondary Structure 10 50 20 30 40 Symbolic Notation 5'-End 3'-End Phenylalanyl-tRNA as an example for the computation of the partition function
G first suboptimal configuration ∆ 0 E = 0.43 kcal / mole → 1 3’ 5’ tRNA phe without modified bases
G C G G A U U U A G C U C A G D D G G G A G A G C MC C A G A C U G A A Y A U C U G G A G MU C C U G U G T P C G A U C C A C A G A A U U C G C A C C A A C C A C G C U U A A G A C A C C U A G C P T G U G U C C U MG A G G U C U A Y A A G U C A G A C C M C G A G A G G G D D G A C U C G A U U U A G G C G G C G G A U U U A G C U C A G D D G G G A G A G C MC C A G A C U G A A Y A U C U G G A G M U C C U G U G T P C G A U C C A C A G A A U U C G C A C C A G C A P U T C G C C U A U C G G M C U C C A A A A C G C U U A A G G G A Y G C G G A U U U U C U C C A A A M G G A C A C U C G G U A C G A A G G D G G D first suboptimal configuration ∆ 0 E = 0.94 kcal / mole → 1 3’ 5’ phe tRNA with modified bases G C G G A U U U A G C U C A G D D G G G A G A G C MC C A G A C U G A A Y A U C U G G A G MU C C U G U G T P C G A U C C A C A G A A U U C G C A C C A
Recommend
More recommend
