rna rna interaction prediction with stochastic grammars
play

RNA-RNA Interaction Prediction with Stochastic Grammars Sebastian - PowerPoint PPT Presentation

May 20, 2023 •186 likes •481 views

RNA-RNA Interaction Prediction with Stochastic Grammars Sebastian Wild Markus Nebel Anika Scheid {s_wild,nebel}@cs.uni-kl.de Fachbereich Informatik 5. October 2012 10. Herbstseminar der Bioinformatik Sebastian Wild RNA-RNA Interaction

  1. RNA-RNA Interaction Prediction with Stochastic Grammars Sebastian Wild Markus Nebel Anika Scheid {s_wild,nebel}@cs.uni-kl.de Fachbereich Informatik 5. October 2012 10. Herbstseminar der Bioinformatik Sebastian Wild RNA-RNA Interaction Prediction 2012/10/05 1 / 12

  2. RNA secondary structure: model primary structure: � � word over a, c, g, u secondary structure: � � parentheses word ( , | , ) gcccugauagcguagucacuagcgagucuguauucuaagaagaucacugaggguucgcgggg | ( ( ( ( ( | ( ( ( ( | | | ) ) ) ) | | ( ( | | ( ( ( | | | | ) ) ) ) ) | | | ( ( | | ( ( | | | | | ) ) | ) ) | | ) ) ) ) ) Sebastian Wild RNA-RNA Interaction Prediction 2012/10/05 2 / 12

  3. RNA also interacts! C G C C G C G A U G 5' U U G C A A U U A A U U A G A G C C G C C U A 41 nt C A U G A U A G A U C C G C G G G G C U U A C U bacterial antisense RNA A U C G U A U 3' A A U G A C C G G C G C U A U U A C G OxyS G A interact non-trivally, A U U A A C G C G C C G A U G C C A U U A A U U U U A C G U “knotted” structure U A A U A U C C G A U C A C U A A U G C C C A G A U A U U A U C G A G A U U CopT C A G U G U U A C U A U C G G C CopA G A C G U goal: predict whole G C C G G C G G U A U U G C C G G U G G G CC C A U G C C G G C C C C A G U A U interaction structure, C C G G C U A A U A C G U C A U A C U A A C G U A U A G not only interaction sites C U U 5' C G 3' C G U C fhlA A U A U G A C G G C A C U A G U 5' A U AUACACCGA U G C 3' 29bp 3' 5' Sebastian Wild RNA-RNA Interaction Prediction 2012/10/05 3 / 12

  4. RNA-RNA interaction problem (RIP) two RNA molecules interact, i. e. form a joint secondary structure predict the “best” one possible RIP in general NP -complete � restrict structure Exclude pseudo knots (internal & external) 1 Exclude Zig-Zags : 2 Sebastian Wild RNA-RNA Interaction Prediction 2012/10/05 4 / 12

  5. Example joint secondary structure � joint structure can be encoded as “2D-word” : pair of upper and lower word matching ( ) � internal bond matching [ ] � external bond (between two molecules) | � unpaired base [ [ [ [ [ � � ( ( | | ) ) ( ( ) ) ( ( ||) ) [ [ [ ( ( [ [ ) ) � ( ] ] ] ( ( ] ] ) ) ) ( ( ( ) ) ) ] ] ] ] ] Sebastian Wild RNA-RNA Interaction Prediction 2012/10/05 5 / 12

  6. Stochastic CFG Stochastic Context-free Grammars G = ( N, Σ, R, S, P ) nonterminals N terminal alphabet Σ � ⋆ � rule set R ⊂ N × N ∪ Σ start nonterminal S ∈ N P : R → [ 0, 1 ] : rule probabilities Probability of a derivation tree : Product of used rules’ probabilities For structure prediction: � � Σ = | b , ( b , ) b : b ∈ { a, c, g, u } unambiguous w. r. t. structure Sebastian Wild RNA-RNA Interaction Prediction 2012/10/05 6 / 12

  7. Structure Prediction with Formal Grammars training data Grammar prediction data ggcggugcca terminals ACGU auggugggugccaa structure annotations ( ( ( | | | ) ) ) | induces compute parametric parse trees stochastic model rel. rule freq. for secondary str. training phase compute most likely parse tree for sequence most likely structure auggugggugccaa | ( ( ( ( | | | | ) ) ) ) | Sebastian Wild RNA-RNA Interaction Prediction 2012/10/05 7 / 12

  8. Structure Prediction with Formal Grammars training data Grammar prediction data ggcggugcca terminals ACGU auggugggugccaa structure annotations ( ( ( | | | ) ) ) | induces compute parametric parse trees stochastic model rel. rule freq. for secondary str. training phase compute most likely parse tree for sequence Both can all be done with the same stochastic parser . most likely structure auggugggugccaa | ( ( ( ( | | | | ) ) ) ) | Sebastian Wild RNA-RNA Interaction Prediction 2012/10/05 7 / 12

  9. Stochastic CFG Stochastic Context-free Grammars G = ( N, Σ, R, S, P ) nonterminals N terminal alphabet Σ � ⋆ � rule set R ⊂ N × N ∪ Σ start nonterminal S ∈ N P : R → [ 0, 1 ] : rule probabilities Sebastian Wild RNA-RNA Interaction Prediction 2012/10/05 8 / 12

  10. 2 -dimensional CFG 2 -dimensional Context-free Grammars G = ( N, Σ, R, S, P ) nonterminals N terminal alphabet Σ N ∪ ( Σ ⋆ ) 2 � ⋆ � rule set R ⊂ N × start nonterminal S ∈ N P : R → [ 0, 1 ] : rule probabilities Sebastian Wild RNA-RNA Interaction Prediction 2012/10/05 8 / 12

  11. A Simplistic Grammar for RIP � | � � | � � ( � � ) � � ( � � ) � S → , S → S, S → S , S → S S � � � � � � � � � � � � S → , S → S, S → S , S → S S | | ( ) ( ) � [ � [ � � S → , S → S ] ] Example: S Sebastian Wild RNA-RNA Interaction Prediction 2012/10/05 9 / 12

  12. A Simplistic Grammar for RIP � | � � | � � ( � � ) � � ( � � ) � S → , S → S, S → S , S → S S � � � � � � � � � � � � S → , S → S, S → S , S → S S | | ( ) ( ) � [ � [ � � S → , S → S ] ] Example: � | � S Sebastian Wild RNA-RNA Interaction Prediction 2012/10/05 9 / 12

  13. A Simplistic Grammar for RIP � | � � | � � ( � � ) � � ( � � ) � S → , S → S, S → S , S → S S � � � � � � � � � � � � S → , S → S, S → S , S → S S | | ( ) ( ) � [ � [ � � S → , S → S ] ] Example: � | �� � � � S S ( ) Sebastian Wild RNA-RNA Interaction Prediction 2012/10/05 9 / 12

  14. A Simplistic Grammar for RIP � | � � | � � ( � � ) � � ( � � ) � S → , S → S, S → S , S → S S � � � � � � � � � � � � S → , S → S, S → S , S → S S | | ( ) ( ) � [ � [ � � S → , S → S ] ] Example: � | �� �� � � �� � S S ( ( ) ) Sebastian Wild RNA-RNA Interaction Prediction 2012/10/05 9 / 12

  15. A Simplistic Grammar for RIP � | � � | � � ( � � ) � � ( � � ) � S → , S → S, S → S , S → S S � � � � � � � � � � � � S → , S → S, S → S , S → S S | | ( ) ( ) � [ � [ � � S → , S → S ] ] Example: �� [ � | �� �� � � �� � S S ( ( ) ) ] Sebastian Wild RNA-RNA Interaction Prediction 2012/10/05 9 / 12

  16. A Simplistic Grammar for RIP � | � � | � � ( � � ) � � ( � � ) � S → , S → S, S → S , S → S S � � � � � � � � � � � � S → , S → S, S → S , S → S S | | ( ) ( ) � [ � [ � � S → , S → S ] ] Example: �� [ �� [ � | �� �� � � �� � S S ( ( ) ) ] ] Sebastian Wild RNA-RNA Interaction Prediction 2012/10/05 9 / 12

  17. A Simplistic Grammar for RIP � | � � | � � ( � � ) � � ( � � ) � S → , S → S, S → S , S → S S � � � � � � � � � � � � S → , S → S, S → S , S → S S | | ( ) ( ) � [ � [ � � S → , S → S ] ] Example: �� [ �� [ �� [ � | �� �� �� �� � S ( ( ) ) ] ] ] Sebastian Wild RNA-RNA Interaction Prediction 2012/10/05 9 / 12

  18. A Simplistic Grammar for RIP � | � � | � � ( � � ) � � ( � � ) � S → , S → S, S → S , S → S S � � � � � � � � � � � � S → , S → S, S → S , S → S S | | ( ) ( ) � [ � [ � � S → , S → S ] ] Example: �� [ �� [ �� [ � | �� �� �� �� �� | � S ( ( ) ) ] ] ] Sebastian Wild RNA-RNA Interaction Prediction 2012/10/05 9 / 12

  19. A Simplistic Grammar for RIP � | � � | � � ( � � ) � � ( � � ) � S → , S → S, S → S , S → S S � � � � � � � � � � � � S → , S → S, S → S , S → S S | | ( ) ( ) � [ � [ � � S → , S → S ] ] Example: �� [ �� [ �� [ � | �� �� �� �� �� | �� | � ( ( ) ) ] ] ] Sebastian Wild RNA-RNA Interaction Prediction 2012/10/05 9 / 12

  20. A Simplistic Grammar for RIP � | � � | � � ( � � ) � � ( � � ) � S → , S → S, S → S , S → S S � � � � � � � � � � � � S → , S → S, S → S , S → S S | | ( ) ( ) � [ � [ � � S → , S → S ] ] Example: �� [ �� [ �� [ � | �� �� �� �� �� | �� | � ( ( ) ) ] ] ] Sebastian Wild RNA-RNA Interaction Prediction 2012/10/05 9 / 12

  21. A Simplistic Grammar for RIP � | � � | � � ( � � ) � � ( � � ) � S → , S → S, S → S , S → S S � � � � � � � � � � � � S → , S → S, S → S , S → S S | | ( ) ( ) � [ � [ � � S → , S → S ] ] Example: [ [ [ | | | ( ( ] ] ] ) ) Sebastian Wild RNA-RNA Interaction Prediction 2012/10/05 9 / 12

  22. A Simplistic Grammar for RIP � | � � | � � ( � � ) � � ( � � ) � S → , S → S, S → S , S → S S � � � � � � � � � � � � S → , S → S, S → S , S → S S | | ( ) ( ) � [ � [ � � S → , S → S ] ] Example: � |[ [ [ || � ((] ] ] )) Sebastian Wild RNA-RNA Interaction Prediction 2012/10/05 9 / 12

Recommend

Prediction of RNA-RNA-Interaction 20 1 15 1 5 10 20 5 10 20 15 10 1 15 5 1 20 10

Prediction of RNA-RNA-Interaction 20 1 15 1 5 10 20 5 10 20 15 10 1 15 5 1 20 10

Prediction of RNA-RNA-Interaction 20 1 15 1 5 10 20 5 10 20 15 10 1 15 5 1 20 10 Can Alkan, Emre Karakoc, Joseph H. Nadeau, S. Cenk Sahinalp, Kaizhong Zhang. RNA-RNA interaction prediction and antisense RNA target search. JCB

627 views • 14 slides
Stochastic Lexical-Functional Grammars Mark Johnson Brown University LFG 2000 Conference July

Stochastic Lexical-Functional Grammars Mark Johnson Brown University LFG 2000 Conference July

Stochastic Lexical-Functional Grammars Mark Johnson Brown University LFG 2000 Conference July 2000 1 Overview What is a stochastic LFG? Estimating property weights from a corpus Experiments with a stochastic LFG Relationship

446 views • 32 slides
Prediction of RNA-RNA Interaction slides by Mathias M ohl and Rolf Backofen ohl M.M c

Prediction of RNA-RNA Interaction slides by Mathias M ohl and Rolf Backofen ohl M.M c

Prediction of RNA-RNA Interaction slides by Mathias M ohl and Rolf Backofen ohl M.M c 1 RNA-RNA interaction (Waters and Storz, Cell 2009) ohl M.M c 2 RNA-RNA interaction U U G U G C G C C C C U C G U U U U

482 views • 15 slides
Minimax strategy for prediction with expert advice under stochastic assumptions Wojciech Kot

Minimax strategy for prediction with expert advice under stochastic assumptions Wojciech Kot

Minimax strategy for prediction with expert advice under stochastic assumptions Wojciech Kot lowski Pozna n University of Technology, Poland Learning Faster from Easy Data II NIPS 2015 Workshop 1 / 3 Prediction with expert advice In

472 views • 9 slides
Parametric Signal Modeling and Linear Prediction Theory 1. Discrete-time Stochastic Processes (2)

Parametric Signal Modeling and Linear Prediction Theory 1. Discrete-time Stochastic Processes (2)

1 Discrete-time Stochastic Processes Appendix: Detailed Derivations Parametric Signal Modeling and Linear Prediction Theory 1. Discrete-time Stochastic Processes (2) Electrical & Computer Engineering University of Maryland, College Park

450 views • 22 slides
Parametric Signal Modeling and Linear Prediction Theory 1. Discrete-time Stochastic Processes

Parametric Signal Modeling and Linear Prediction Theory 1. Discrete-time Stochastic Processes

1 Discrete-time Stochastic Processes Appendix: Detailed Derivations Parametric Signal Modeling and Linear Prediction Theory 1. Discrete-time Stochastic Processes Electrical & Computer Engineering University of Maryland, College Park

1.89k views • 166 slides
Parametric Signal Modeling and Linear Prediction Theory 1. Discrete-time Stochastic Processes

Parametric Signal Modeling and Linear Prediction Theory 1. Discrete-time Stochastic Processes

1 Discrete-time Stochastic Processes Appendix: Detailed Derivations Parametric Signal Modeling and Linear Prediction Theory 1. Discrete-time Stochastic Processes Electrical & Computer Engineering University of Maryland, College Park

303 views • 28 slides
A Multi-Agent Prediction Market based on Raj Dasgupta Partially Observable Stochastic Game

A Multi-Agent Prediction Market based on Raj Dasgupta Partially Observable Stochastic Game

A Multi-Agent Prediction Market based on Partially Observable Stochastic Game Janyl Jumadinova, A Multi-Agent Prediction Market based on Raj Dasgupta Partially Observable Stochastic Game Outline Introduction Research Problem POSGI Janyl

753 views • 46 slides
What is accomplished by successful non stationary stochastic prediction? Glenn Shafer, Rutgers

What is accomplished by successful non stationary stochastic prediction? Glenn Shafer, Rutgers

Workshop on Robust Methods in Probability & Finance ICERM, Brown University, June 19 23, 2017 What is accomplished by successful non stationary stochastic prediction? Glenn Shafer, Rutgers University, www.glennshafer.com Answer: It

738 views • 49 slides
Prediction and speculation : the role of stochastic models of program behaviour in the

Prediction and speculation : the role of stochastic models of program behaviour in the

Prediction and speculation : the role of stochastic models of program behaviour in the performance of modern computers r. innocente 20 Nov 2005 roberto innocente 1 1 Speculation from the Merriam-Webster dict : an assumption of an

842 views • 67 slides
RESEARCH & METHODS RNA-RNA interaction prediction Jerome Waldispuhl School of Computer

RESEARCH & METHODS RNA-RNA interaction prediction Jerome Waldispuhl School of Computer

COMP598: ADVANCED COMPUTATIONAL BIOLOGY RESEARCH & METHODS RNA-RNA interaction prediction Jerome Waldispuhl School of Computer Science, McGill From slides from Ivo Hofacker (University of Vienna) Motivation Experimental and

481 views • 36 slides
ALADIN: A New Approach for Drug Target Interaction Prediction Krisztian Buza a , Ladislav

ALADIN: A New Approach for Drug Target Interaction Prediction Krisztian Buza a , Ladislav

ALADIN: A New Approach for Drug Target Interaction Prediction Krisztian Buza a , Ladislav Peka b a Knowledge Discovery and Machine Learning Rheinische Friedrich-Wilhelms-Universitt Bonn, Germany b Faculty of Mathematics and Physics

370 views • 14 slides
The Interaction of Implied Equity Volatility, Stochastic Interest, and Volatility Control Funds

The Interaction of Implied Equity Volatility, Stochastic Interest, and Volatility Control Funds

Equity-Based Insurance Guarantees Conference Nov. 5-6, 2018 Chicago, IL The Interaction of Implied Equity Volatility, Stochastic Interest, and Volatility Control Funds for Modeling Variable Products Mark Evans SOA Antitrust Compliance

712 views • 23 slides
Stochastic modelling of genome-wide robotic screens for genetic interaction in budding yeast

Stochastic modelling of genome-wide robotic screens for genetic interaction in budding yeast

Experiments Data analysis Summary and conclusions Stochastic modelling of genome-wide robotic screens for genetic interaction in budding yeast Darren Wilkinson http://tinyurl.com/darrenjw School of Mathematics & Statistics, Newcastle

766 views • 34 slides
Nonlinear wave interaction for broad-banded, open seas deterministic and stochastic theory

Nonlinear wave interaction for broad-banded, open seas deterministic and stochastic theory

Nonlinear wave interaction for broad-banded, open seas deterministic and stochastic theory Raphael Stuhlmeier (based on joint work with David Andrade and Michael Stiassnie) 11. March 2019 Structure of this talk: 1. Linear theory and the

973 views • 68 slides
Simherd III A dynamic, mechanistic and stochastic Monte Carlo model prediction the production and

Simherd III A dynamic, mechanistic and stochastic Monte Carlo model prediction the production and

General introduction to Sim herd I I I stergaard et al. 2003 Advanced Herd Managem ent Jehan Ettem a General introduction to Simherd III A dynamic, mechanistic and stochastic Monte Carlo model prediction the production and states of the

629 views • 21 slides
{Probabilistic | Stochastic} Context-Free Grammars (PCFGs) 116 The velocity of the seismic

{Probabilistic | Stochastic} Context-Free Grammars (PCFGs) 116 The velocity of the seismic

{Probabilistic | Stochastic} Context-Free Grammars (PCFGs) 116 The velocity of the seismic waves rises to . . . S NP sg VP sg DT NN PP rises to . . . The velocity IN NP pl of the seismic waves 117 PCFGs A PCFG G consists of: A

498 views • 37 slides
and Shaun Lovejoy Beyond the deterministic limit: GCMs Stochastic scales < 10 days

and Shaun Lovejoy Beyond the deterministic limit: GCMs Stochastic scales < 10 days

Using the ScaLINg Macroweather Model (SLIMM) to exploiting the atmospheres elephantine memory for long- term forecast Stochastic Seasonal to Interannual Prediction System Lenin Del Rio Amador and Shaun Lovejoy Beyond the deterministic

1.6k views • 6 slides
What If We Only Have Stochastic . . . What if the Stochastic . . . Approximate Stochastic

What If We Only Have Stochastic . . . What if the Stochastic . . . Approximate Stochastic

In Finance, We Need . . . How to Make . . . From a Theoretical . . . How to Make . . . What If We Only Have Stochastic . . . What if the Stochastic . . . Approximate Stochastic Additional Reasonable . . . Dominance? The Assumption 0 < .

550 views • 15 slides
Overview Grammars A grammar is a 4-tuple ( N, , S, P ) where Grammars, or: how to specify

Overview Grammars A grammar is a 4-tuple ( N, , S, P ) where Grammars, or: how to specify

Overview Grammars A grammar is a 4-tuple ( N, , S, P ) where Grammars, or: how to specify linguistic knowledge Towards more complex grammar systems Some basic formal language theory N is a finite set of non-terminals Automata, or:

226 views • 3 slides
Synchronous Grammars Synchronous grammars are a way of simultaneously generating pairs of

Synchronous Grammars Synchronous grammars are a way of simultaneously generating pairs of

Synchronous Grammars Synchronous grammars are a way of simultaneously generating pairs of recursively related strings Synchronous grammar w w Synchronous grammars were originally invented for programming language compilation

813 views • 65 slides
Formal Grammars Why Study Grammars? Whats a Grammar? August 24, 2014 Parsing Brian A.

Formal Grammars Why Study Grammars? Whats a Grammar? August 24, 2014 Parsing Brian A.

Formal Grammars Why Study Grammars? Whats a Grammar? August 24, 2014 Parsing Brian A. Malloy Classes of . . . Regular Grammars Slide 1 of 14 Go Back Full Screen Quit 1. Why Study Grammars? Why Study

810 views • 14 slides
Speech and Language Processing Formal Grammars Chapter 12 Today Formal Grammars

Speech and Language Processing Formal Grammars Chapter 12 Today Formal Grammars

Speech and Language Processing Formal Grammars Chapter 12 Today Formal Grammars Context-free grammar Grammars for English Treebanks Dependency grammars Speech and Language Processing - Jurafsky and Martin 8/12/08 2 Syntax

679 views • 50 slides
Protein Interaction Prediction: The PIPE and InSiPS Projects Frank Dehne School of Computer

Protein Interaction Prediction: The PIPE and InSiPS Projects Frank Dehne School of Computer

Protein Interaction Prediction: The PIPE and InSiPS Projects Frank Dehne School of Computer Science Centre For Advanced Studies Canada Frank Dehne www.dehne.net Parallel Computational Biochemistry Protein-Protein Interactions Frank Dehne

830 views • 49 slides

More recommend