computational methods rna secondary structure chembnet
play

Computational Methods RNA Secondary Structure. chEMBnet RNA05, - PowerPoint PPT Presentation

Apr 08, 2023 •131 likes •539 views

Computational Methods RNA Secondary Structure. chEMBnet RNA05, 2005/9/30 Michael Zuker Department of Mathematical Sciences Rensselaer Polytechnic Institute Troy, NY. Credit: Supported in part by grant #GM54250 to MZ (NIGMS)

  1. Computational Methods RNA Secondary Structure. chEMBnet RNA05, 2005/9/30 Michael Zuker Department of Mathematical Sciences Rensselaer Polytechnic Institute Troy, NY. Credit: • Supported in part by grant #GM54250 to MZ (NIGMS) • “HYBRID” package: Nick Markham • Secondary structure and dot plot software: Darrin Stewart • RNA energy parameters: Doug Turner, David Mathews et al. • Web server – Cluster of 36 dual processor Linux computers donated by IBM Res. (SUR grant to MZ) – Sys. Admin. by Alex Yu – Secure home at the Voorhees Computer Center.

  2. G A G U A U U G A U C G A G A U G G C U U C C H I I B A U C U G C C G A A G G A U C U A A G A A U A A C G G Bacillus subtilis RNase P RNA C C G C A I M - multi-loop A G C U A I - interior loop C G G A G B - bulge loop U G I G A H - hairpin loop A U A A U C A G U G C G C U A A H B G U U C G A U G A C G U C C G C G A G A G A G A U U C U C A C U A M H A G A G U G G U A G A G C U G G U A U A G G 5’ C U U G G A C A U U A U G G C C C G U G G A H M H 3’ B C A A C G G G C A C C U G U C U C C U U C A C C A G U G C A U C G U A U A G A A G U U A C G H H A A U U G C U G C A U C C C C G A U G C A U G G A G G A U A G U C A A A G A U G A U A A A C G C U A G U A G G U A A U C G C C C C U M M H A C C G U U A G U G G G U U G G A G U C A G G A C U G A A A A C A U U G A C G A C A U G G A A U A C H M C G U A G U G C G A A G G A C U U U A G A A A C U A C G G H U U U G C G A G G A U A G G A U C A G U A C A A I I U U A H C C G G C G G G U G G U U C A H A A A U C U Traditional RNA secondary structure plot

  3. Circular plot – What good is it? Output of sir_graph 210 by D. Stewart and M. Zuker 180 A U A U G G C U G A G U A U C C U U G A A A G U G C C A C A G U G A C G A A G U C U C A C U A G A A A U G G U G A G A G U G G A A C G C G G U A A A C C C C U C G A G C G A G A A A C C 240 150 G C G A C A U A U U C U U U G U C G A G U U C A C G G G 270 A G A G A A A A A C A C G U G U A C C U G U G A C A A C G G U G C A G A G U 120 A U G C A A U A U C U G C G U A G G A A C G G A G A G G A G U 300 A C C G A A G A A U A A U C G U C G U A U A U G C C U G G A U U A C G C 90 A G U U A G G C A U U U G G A U U G U A G U C G C C G C C C C 330 G U U G A A G G A U G A U C C G G A U G G G G U C G A A C U G G C A U G C C 60 G C U G A U C U C U U G G C A A A G A U G A G C A G G A A U U G G 360 G U A C A U C A A A A G A U A U C C A U U A G G A G C C U G U U A C C G A C G U A A A A U C G G 30 G G U U C G A U U C A G C A A C A U U C U U U C U G 1 401 ENERGY = -85.7 Bacillus subtilis RNase P RNA

  4. What is a pseudoknot? Mathematical: r 1 r 2 r 3 . . . r n – sequence of an RNA Two base pairs (BPs), r i · r j and r i ′ · r j ′ , can be called “incompatible” if i < i ′ < j < j ′ . A pseudoknot is created by two “stems” (helices) that are incompatible. That is, every BP in one is incompatible with every BP in the other. Example of a simple pseudoknot. A-C 3´- A-G-G-C-U/ U U-C-C-G-A-G-G-G U C-C-C - 5´ C--U--C/ Stem 1: C 1 · G 15 , C 2 · G 14 , C 3 · G 13 , is incompatible with Stem 2: U 8 · A 23 , C 9 · G 22 , C 10 · G 21 , G 11 · C 20 , A 12 · U 19 . Is this possible? – Yes.

  5. 3D model of simple pseudoknot.

  6. 12 A G G 14 10 G C G C 16 U 8 U C U A 18 C 6 U U C 20 C 4 G C G C A C 2 1 23 Intersecting BP arcs indicate a pseudoknot

  7. U G C A A A G C P9.1a U A G C A U A G G G U A 340 A G 360 G C P9.1 G C C G G C A U U G 380 P9 P9.2 C G G A A C U A A U U U G U A U G C GA AU G G G A G A A U U C C U C U U G A U U A G U A U A U G A U U 320 400 U A G C G A G A C A A 3’ G C U A U A G U U G C A 200 G C C GU U A a U U P5a G U 120 P10 A U A u A C C U G P5 G C C g C C G C G U A C A U A g U A P9.0 C G C G U a C G G G 20 U A a u G U A A U U A A U G C A A G u P1 A A C G G c A U A A U A A u A P7 G C G C 180 G c C G P5c G C G u A U A A A G GG U A U C G 5’ A U A A C G c 260 G G C C A A P4 C A C G U G U C C A U G U A U G A 140 A U U G A C G A U G U U P6 U U 160 G C C G A A G G C A U C A P3 C G G C 100 P5b A U U A C G A U A C G G A U U G A A G A C G C U G U A 220 G U C G 80 U A U U A P6a A G A C 300 C G A A A G C G C G C G 280 C G U U U G A U P2.1 A C G A U A P8 A U A A U G U U A U A U A C G U AA C G U A U A A U U U C G 60 P6b A U A G U G C G U G C A U A 240 G C A A U A U C U A A A Tetrahymena thermophila LSU rRNA A U G C U G GenBank# J01235 P2 U A A U Eucarya, Protoctista, Ciliophora (IC1) U G C G Jun 09, 1994 A U G C 40 G C C A A U GC Can you find the pseudoknot?

  8. 210 240 180 G A U G G C C U U G C A A A G G G U A U G G U A A U A A G C U G A C G G A C A U G G U C C U A A C C A C G C A G C C A A G U C C U A A G U C A A C A G A U C U U C U G U U G A U A U G G A U G C 270 A A G G U U U U U C 150 C A A C A A A G G A G C G U G A A A C A U U C G U U G C A G A G C U C C A G U G G G A G C A U A U G G A C U C G G U A A C 300 U A U A C C U U U G 120 C G U G C G A A U A A A A G G G A G U C A G U U A U G A U A C A G C G U A G C C C C U A C G U A C A C C U G U G A A 330 A A U A G A G U G 90 U A U G G C G U C A U G A C C G G G U A U U A G G A A A U G A U A G C A C U A G A C A A U A U C U A C C U U G G A G U 360 A C G G C A C U G G 60 C G U U G C G C G A A C A G C U U A A C A G U G U A U C G U U A A U U U G G C A G A A A A A A G G G U G A A U G A G U U U U U G C A C U A A U 390 U G U U U A U U U U A A G G C G G A 30 A U A A U A A U G C U C C U C U C 1 419 Tetrahymena thermophila LSU rRNA Now you can. P3 and P7 create a pseudoknot.

  9. U G C A A A G C P9.1a U A G C A U A G G G U A 340 A G 360 G C P9.1 G C C G G C A U U G 380 P9 P9.2 C G G A A C U A A U U U G U A U G C GA AU G G G A G A A U U C C U C U U G A U U A G U A U A U G A U U 320 400 U A G C G A G A C A A 3’ G C U A U A G U U G C A 200 G C C GU U A a U U P5a G U 120 P10 A U A u A C C U G P5 G C C g C C G C G U A C A U A g U A P9.0 C G C G U a C G G G 20 U A a u G U A A U U A A U G C A A G u P1 A A C G G c A U A A U A A u A P7 G C G C 180 G c C G P5c G C G u A U A A A G GG U A U C G 5’ A U A A C G c 260 G P3 and P7 create G C C A A P4 C A C G U G U C C A U G U A U G A 140 a pseudoknot A U U G A C G A U G U U P6 U U 160 G C C G A A G G C A U C A P3 C G G C 100 P5b A U U A C G A U A C G G A U U G A A G A C G C U G U A 220 G U C G 80 U A U U A P6a A G A C 300 C G A A A G C G C G C G 280 C G U U U G A U P2.1 A C G A U A P8 A U A A U G U U A U A U A C G U AA C G U A U A A U U U C G 60 P6b A U A G U G C G U G C A U A 240 G C A A U A U C U A A A Tetrahymena thermophila LSU rRNA A U G C U G GenBank# J01235 P2 U A A U Eucarya, Protoctista, Ciliophora (IC1) U G C G Jun 09, 1994 A U G C 40 G C C A A U GC Now you can see them in the original plot.

  10. 220 Output of sir_graph by D. Stewart and M. Zuker C U U U C A G C G G G C G G A A A A G C C U C G G C C 230 210 A U G G U C C 240 C G G C C U C C 200 U U U U C U Sometimes they C U A U C G are complicated. C U 250 G C U G Jiunn-Liang Chen & Carol W. Greider U C C 190 G A C Functional analysis of the pseudoknot U G U C C structure in human telomerase RNA (20 C U C A C PNAS 102:23 , pp 8080–8085 G U 260 A C G G C U A 180 U A U A U C C A G A U A G A C A 270 C A G U C G G U G 170 C A A U G G C C G U G 161 Human telomerase RNA (AF221907) pseudoknot

Recommend

Methods &amp; Research Introduction to RNA secondary structure prediction Jrme Waldisphl

Methods &amp; Research Introduction to RNA secondary structure prediction Jrme Waldisphl

COMP598: Advanced Computational Biology Methods &amp; Research Introduction to RNA secondary structure prediction Jrme Waldisphl School of Computer Science, McGill RNA world In prebiotic world, RNA thought to have filled two distinct

626 views • 33 slides
CSEP 527 Computational Biology RNA: Function, Secondary Structure Prediction, Search, Discovery

CSEP 527 Computational Biology RNA: Function, Secondary Structure Prediction, Search, Discovery

CSEP 527 Computational Biology RNA: Function, Secondary Structure Prediction, Search, Discovery The Message noncoding RNA Cells make lots of RNA Functionally important, functionally diverse Structurally complex New tools required alignment,

811 views • 62 slides
CSE 527 Autumn 2007 Lectures 17-18 RNA Secondary Structure Prediction RNA Secondary Structure:

CSE 527 Autumn 2007 Lectures 17-18 RNA Secondary Structure Prediction RNA Secondary Structure:

CSE 527 Autumn 2007 Lectures 17-18 RNA Secondary Structure Prediction RNA Secondary Structure: RNA makes helices too U CA A C G Base pairs G AC G C A U A U C G C G A U G CA A A AU C Fastest Human Gene? Origin of

716 views • 48 slides
CSE 527 Autumn 2006 Lectures 15-16 RNA Secondary Structure Prediction RNA Secondary Structure:

CSE 527 Autumn 2006 Lectures 15-16 RNA Secondary Structure Prediction RNA Secondary Structure:

CSE 527 Autumn 2006 Lectures 15-16 RNA Secondary Structure Prediction RNA Secondary Structure: RNA makes helices too U CA A C G Base pairs G AC G C A U A U C G C G A U G CA A A AU C Fastest Human Gene? Origin of

852 views • 48 slides
Biological Engineering Education and Computational Methods Effect of the Geometrical Structure

Biological Engineering Education and Computational Methods Effect of the Geometrical Structure

Biological Engineering Education and Computational Methods Effect of the Geometrical Structure of Mitochondria on the Synthesis and Diffusion of Oxidative Metabolites Rajan Gangadharan 1 and Dr.Guigen Zhang 1,2,3 1 Micro/Nano Bioengineering

578 views • 14 slides
Computational Methods in Protein Structure Prediction C.A. Floudas Department of Chemical

Computational Methods in Protein Structure Prediction C.A. Floudas Department of Chemical

P ERSPECTIVE Computational Methods in Protein Structure Prediction C.A. Floudas Department of Chemical Engineering, Princeton University, Princeton, New Jersey 08544-5263; telephone: 1-609-258-4595; fax: 1-609-258-0211; e-mail:

87 views • 7 slides
Secondary structure and amino acid properties Magnus Andersson magnus.andersson@scilifelab.se

Secondary structure and amino acid properties Magnus Andersson magnus.andersson@scilifelab.se

Protein Physics 2016 Lecture 4, January 29 Secondary structure and amino acid properties Magnus Andersson magnus.andersson@scilifelab.se Theoretical &amp; Computational Biophysics Recap Hydrophobic e ff ect Solubility &amp;

629 views • 40 slides
Secondary structure stability, beta-sheet formation &amp; stability Magnus Andersson

Secondary structure stability, beta-sheet formation &amp; stability Magnus Andersson

Protein Physics 2016 Lecture 6, February 5 Secondary structure stability, beta-sheet formation &amp; stability Magnus Andersson magnus.andersson@scilifelab.se Theoretical &amp; Computational Biophysics Recap of statistics Energy -

397 views • 26 slides
Outline CSEP 590A Summer 2006 Biological roles for RNA What is secondary structure? Lecture

Outline CSEP 590A Summer 2006 Biological roles for RNA What is secondary structure? Lecture

Outline CSEP 590A Summer 2006 Biological roles for RNA What is secondary structure? Lecture 8 How is it represented? RNA Secondary Structure Prediction Why is it important? Examples Approaches RNA Structure RNA Pairing Watson-Crick

380 views • 12 slides
RNA Search and Motif Discovery CSEP 527 Computational Biology Previous Lecture

RNA Search and Motif Discovery CSEP 527 Computational Biology Previous Lecture

RNA Search and Motif Discovery CSEP 527 Computational Biology Previous Lecture Many biologically interesting roles for RNA RNA secondary structure prediction 1 2 Approaches to Structure Prediction Maximum Pairing + works on

840 views • 71 slides
Structure-preserving numerical methods in relativity Douglas N. Arnold, University of Minnesota

Structure-preserving numerical methods in relativity Douglas N. Arnold, University of Minnesota

Structure-preserving numerical methods in relativity Douglas N. Arnold, University of Minnesota Advances and Challenges in Computational Relativity September 14, 2020 ICERM Structure-preserving discretization Structure-preserving

502 views • 49 slides
CSEP 590A Summer 2006 Lecture 8 RNA Secondary Structure Prediction Outline Biological roles

CSEP 590A Summer 2006 Lecture 8 RNA Secondary Structure Prediction Outline Biological roles

CSEP 590A Summer 2006 Lecture 8 RNA Secondary Structure Prediction Outline Biological roles for RNA What is secondary structure? How is it represented? Why is it important? Examples Approaches RNA Structure Primary Structure:

476 views • 46 slides
Computational Sustainability: Computational Methods for a Sustainable Environment, Economy, and

Computational Sustainability: Computational Methods for a Sustainable Environment, Economy, and

Computational Sustainability: Computational Methods for a Sustainable Environment, Economy, and Society Optimal Forest Fire Fuel Management and Timber Harvest In The Face Of Endogenous Spatial Risk The Next Step Cl i Claire Montgomery M t

332 views • 17 slides
Supervised Convolutional GSN for Protein Secondary Structure Prediction Jian Zhou Olga

Supervised Convolutional GSN for Protein Secondary Structure Prediction Jian Zhou Olga

Supervised Convolutional GSN for Protein Secondary Structure Prediction Jian Zhou Olga Troyanskaya Princeton University Whats In this talk.. Problem: Predict protein secondary structure Iterative prediction with multi-layer

297 views • 13 slides
Outline CSE 527 What is it Lecture 17, 11/24/04 How is it Represented RNA Secondary

Outline CSE 527 What is it Lecture 17, 11/24/04 How is it Represented RNA Secondary

Outline CSE 527 What is it Lecture 17, 11/24/04 How is it Represented RNA Secondary Structure Prediction Why is it important Examples Approaches RNA Structure RNA Pairing Watson-Crick Pairing Primary Structure:

414 views • 8 slides
Evaluate non-destructive methods to assess the condition of the secondary containment liners in

Evaluate non-destructive methods to assess the condition of the secondary containment liners in

1/23/19 Valdez Marine Terminal Secondary Containment Liner Integrity Evaluation Jay L. Griffin, P .E. Project Engineer 25 January 2019 Purpose Evaluate non-destructive methods to assess the condition of the secondary containment liners in

402 views • 12 slides
Protein Structure Bioinformatics Introduction Secondary Structure Prediction &amp; Fold

Protein Structure Bioinformatics Introduction Secondary Structure Prediction &amp; Fold

Introduction to Protein Structure Bioinformatics 29.9.2004 Protein Structure Bioinformatics Introduction Secondary Structure Prediction &amp; Fold recognition EMBnet course Basel, September 29, 2004 Lorenza Bordoli Swiss Institute of

377 views • 35 slides
A COMPARISON OF RNA HOMOLOGY-DETECTING SOFTWARE Justin Slotman Bioinformatics Masters Thesis

A COMPARISON OF RNA HOMOLOGY-DETECTING SOFTWARE Justin Slotman Bioinformatics Masters Thesis

A COMPARISON OF RNA HOMOLOGY-DETECTING SOFTWARE Justin Slotman Bioinformatics Masters Thesis December 2008 The problem of RNA secondary structure prediction Primary structure does not necessarily imply secondary structure Secondary

668 views • 47 slides
Lecture 22 Computational Methods for GPs Colin Rundel 04/12/2017 1 GPs and Computational

Lecture 22 Computational Methods for GPs Colin Rundel 04/12/2017 1 GPs and Computational

Lecture 22 Computational Methods for GPs Colin Rundel 04/12/2017 1 GPs and Computational Complexity 2 2 exp n 1 i The problem with GPs x n 2 j 2 ij d ij Update covariance parameter? n 3 log 2 2 n 1 Unless you are lucky (or

772 views • 48 slides
Linear algebra in ab initio computational chemistry Evgeny Epifanovsky September 18, 2018

Linear algebra in ab initio computational chemistry Evgeny Epifanovsky September 18, 2018

Linear algebra in ab initio computational chemistry Evgeny Epifanovsky September 18, 2018 Atomistic simulations in chemistry: Molecular mechanics methods (structure and properties of large molecules) Plane-wave electronic structure

191 views • 4 slides
Silberschatz and Galvin Chapter 13 Secondary Storage Structure CPSC 410--Richard Furuta 3/30/99

Silberschatz and Galvin Chapter 13 Secondary Storage Structure CPSC 410--Richard Furuta 3/30/99

CPSC 410-501 Fall 1994 Silberschatz and Galvin Chapter 13 Secondary Storage Structure CPSC 410--Richard Furuta 3/30/99 1 Secondary Storage Structure Topics Disk Structure Disk Scheduling Disk Management Swap-Space Management

385 views • 16 slides
Module 13: Secondary-Storage Structure Disk Structure Disk Scheduling Disk Management

Module 13: Secondary-Storage Structure Disk Structure Disk Scheduling Disk Management

' $ Module 13: Secondary-Storage Structure Disk Structure Disk Scheduling Disk Management Swap-Space Management Disk Reliability Stable-Storage Implementation &amp; % Silberschatz and Galvin c Operating System Concepts

201 views • 18 slides
RNA Secondary Structure aagacuucggaucuggcgacaccc uacacuucggaugacaccaaagug

RNA Secondary Structure aagacuucggaucuggcgacaccc uacacuucggaugacaccaaagug

RNA Secondary Structure aagacuucggaucuggcgacaccc uacacuucggaugacaccaaagug aggucuucggcacgggcaccauuc ccaacuucggauuuugcuaccaua aagccuucggagcgggcguaacuc Hairpin Loops Interior loops Stems Multi-branched loop Bulge loop Context Free Grammars

416 views • 27 slides
Part 1 How can computational NMR contribute to structure determination of proteins with

Part 1 How can computational NMR contribute to structure determination of proteins with

Part 1 How can computational NMR contribute to structure determination of proteins with paramagnetic center? Ji Mare University of Oulu 2014 Start 17.1.2013 . . . we are sending the structure and the experimental pcs of a

434 views • 41 slides

More recommend