Analysis of HIV-1-specific CTL in the Dsseldorf Patient Thomas - PowerPoint PPT Presentation

Analysis of HIV-1-specific CTL in the „Düsseldorf“ Patient Thomas Harrer Infectious Diseases and Immunodeficiency Unit Department of Medicine 3

Düsseldorf Patient: HIV-1-specific Immunity?  Did the new host develop an HIV-1-specific immunity?  If yes, how strong is the HIV-1-specific CTL response  HIV-1-specific CTL could play an important role in the eradicaton of the HIV-1 reservoir  High frequencies of HIV-1-specific CTL would indicate active HIV-1 replication and HIV-1 persistence  Secondary decline of HIV-1-specific CTL indicate lack of antigenic stimulation. 2

Analysis of HIV-1-specific CTL: 2015/ 2016 ( patient still on tacrolimus)  HLA-I type: A2,A24, B7, C7  ELISPOT with freshly isolated PBMC:  PBMC were isolated by Ficoll and rested overnight in R10  ELISPOT with 12 peptides corresponding to known CTL epitopes and two proteins  A2: p17-SL9, RT: IV9, VL9, VL9-V, YV9, PR: KI10-M Nef: PL10, PL10-F.  A24: gp41-EL9, p24-Il8  B7: Nef: FL9, FL9-T, TM9, RL9,  C7: Nef-RY10  20-AA long Gag-Peptides 2 and 5.  Proteins: gp120, p24  positive control: PHA  3

Analysis of HIV-1-specific CTL:  Results:  very weak response to PHA due to immunosuppression  no significant specifc response to peptides  non-significant reaction to Nef7-FL9 No peptide PHA PHA in other patient 4

Analysis of HIV-1-specific CTL: Peptide Stimulation Assay Stimulation with Peptides + IL2 für 1-2 weeks, then ELISPOT  detects low frequency CTL (1: 2-5 Mill.)  detects naive cells and resting memory cells  PBMC were stimulated with 6 peptides corresponding to known CTL epitopes in R10 + IL2  Peptides used for stimulation:  P17-SL9, RT IV9, RT YV9, Nef-TM9, gp41-EL9, Nef-RY10  Outgrowing cell lines were tested after two weeks for peptide recognition in a γ -IFN ELISPOT assay 5

Recognition of RT-peptide YV9 by peptide stimulated CTL no peptide RT-YV9 peptide no peptide RT-YV9 peptide Blood from 10/ 2015 Blood from 2/ 2016 Limiting dilution assays revealed a CTL precursor frequency of ~ 1: 2000 cells within the PBMC 6

DP: PBMC: d32 1 – H2O ctgcagctctcattttccata catt aaa 2 – CCR5 wt gatagtcatcttggggctggtcctgcc 3 – CCR5∆32 heterozygous gctgcttgtcatggtcatctgctactcg 4 – CCR5∆32 homoygous ggaatcctaaaaactctgcttcggtgt 5 – PBMC patient cgaaatgagaagaagaggcacaggg 6 RTYV9-CTL line ctgtgaggcttatcttcaccatcatgat 7 –Nef-fl9-line tgtttattttctcttctgggctccctaca acattg 8 – GenLadder 50bp (Genaxxon) 9 – Low Molecular Weight DNA DP RT YV9-CTL line: d32 Ladder ( NEB) ctgcagctctcattttccata catt aaa gatagtcatcttggggctggtcctgcc gctgcttgtcatggtcatctgctactcg The RTYV9 CTL ggaatcctaaaaactctgcttcggtgt cGaaatgagaagaagaggcacagg carry the d32 deletion in CCR5 gctgtgaggcttatcttcaccatcatga ttgtttattttctcttctgggctccctaca acattgtccttctcctgaa The RTYV9 CTL are donor derived

Peptide stimulation assays with peptide pools 7/ 2016 Epitope mapping peptide pool 12/ 13 1200 1000 800 600 400 200 0  KL9: not recognized KELYPLASL EPID KELYPLASLRS 120 not recognized KE LYPLASLRSL FGN 121 recognized PLASLRSLFGN DPSS 122 not recognized LYPLASLRSL recognized L Y PLASLRS L A24 epitope Y P LASLRS L B7 epitope 8

Stem cell donor : Test on 10 th of Jan.2018  Elispot with freshly isolated PBMC: 250 000 cell/ well  RT50YV9: A2  Gag07-121, YL9, LL19  Nef7-V2: B7  Nef11T3: C7  PHA: weak response, transport issue?  Stimulation of 5 Mill. PBMC each with peptides corresponding to CTL epitopes recognized by the Düsseldorf patient.  Gag07-121  Gag-LL10: A24  YL9: B7  RTYV9: A2  No significant response 9

Düsseldorf-Patient: 14.March 2018  Elispot with freshly isolated PBMC: 200 000 cells/ Well  37 peptides, corresponding to HIV-CTL-epitopes, 5 peptides and proteines corresponding to JCV, EBV, IMP, CMV. Good response to positive controls PHA and ConA: No response to HIV-specific epitopes. Therefore, there is no sign of viral immune stimulation arguing against a significant viral replication. However, this cannot rule out replication below threshold 10

Düsseldorf-Patient: 14.3.18  Stimulation of 5 Million PBMC with peptides:  Testung after 10 days: RT50 YV9 (A2): YQYMDDLV +++ RT50yV9 Gag7-121 : KE LYPLASLRSL FGN + + LL10: L Y PLASLRS L + + A24/B27 epitope YL9: Y P LASLRS L - B7 epitope 11

Gag-specific CTL lines contain the Delta32-CCR5-Deletion 1. B-cell wild type 1 2 3 4 5 6 2. Düsseldorf patient B-cell 3. DNA ladder 4. B-cell heterozygous 5. Düsseldorf patient Gag CTL 6. Negative control 12

Düsseldorf-Patient: 6.2.2019  Elispot with freshly isolated PBMC: 200 000 cells/ Well  37 peptides, corresponding to HIV-CTL-epitopes, 5 peptides and proteines corresponding to JCV, EBV, IMP, CMV. EBV Good response to positive controls PHA and ConA: No response to HIV-specific epitopes. Therefore, there is no sign of viral immune stimulation arguing against a significant viral replication. However, this cannot rule out replication below threshold 13

Düsseldorf-Patient: 3.4.2019  Elispot with freshly isolated PBMC: 200 000 cells/ Well  37 peptides, corresponding to HIV-CTL-epitopes, 5 peptides and proteines corresponding to JCV, EBV, IMP, CMV. Flu EBV Good response to positive controls PHA and ConA: No response to HIV-specific epitopes. Low, borderline response to flu and EBV peptides Therefore, there is no sign of viral immune stimulation arguing against a significant viral replication. However, this cannot rule out replication below threshold 14

Recognition of HIV-1-epitopes by peptide – stimulated CTL lines in ELISPOT assays 11/ 17 Stop of 11/ 18 Stop of ART immunosuppression 1400 1200 1000 Spot forming Units RTYV9 800 gag07-21 Gag-YL9 600 Gag-LL10 400 200 0 28.10.2015 29.01.2016 22.07.2016 08.12.2017 14.03.2018 12.12.2018 06.02.2019 03.04.2019 15

Summary I:  The donor developed HIV-1-specific CTL against three functional important CTL epitopes in RT and Gag  Despite tacrolimus therapy, CTL lines against RT YV9 and GAG epitopes grew well after peptide stimulation  These CTL were not detectable in ELISPOT assays with freshly isolated PBMC presumably to the iatrogenic immunosuppression 16

Summary II: After Stopp of Tacrolimus in 2018:  No detection of CTL effector cells using freshly isolated PBMC in g-IFN- ELISPOT assays  Good outgrowth of CTL after stimulation with peptides and IL2.  This may be due to  Low frequency of effector CTL (<1:100 000, but RT YV9 frequency 1:2000)  Presence of memory cells which have not seen virus for a while and thus need costimulation in addition to the peptide.  This is indicating that viral replication is absent or low below threshold of immune activation.  However, this cannot rule out small amounts of residual virus. 17

Summary III:  CTL against these epitopes were not detected in the donor´s PBMC.  This indicates that the new donor developed an immune response to HIV-1 surviving transplantation procedure despite strong immunosuppression  HIV-1-specific CTL could help to decrease viral reservoirs:  Graft versus virus response could help in clearance of HIV. 18

Summary IV: after stopp of ART  In the follow up after stopp of ART loss of recognition of RTYV9-specific CTL  Decrease of Gag-specific CTL  Potential reasons:  anergy: not probable as no medical immunosuppression, good PHA- stimulation  CTL escape mutation: not probable as no viral replication  lack of antigenic stimulation due to low viral burden: probable  Gag versus RT: per virion much more Gag-protein than RT, therefore, stronger stimulation by Gag 19

Acknowledgment Christiane Mummert Silke Bergmann Björn Jensen Guido Kobbe Rolf Kaiser, Elena Knops, Eva Heger 20