Analysis of HIV-1-specific CTL in the Dsseldorf Patient Thomas - PowerPoint PPT Presentation

Analysis of HIV-1-specific CTL in the „Düsseldorf“ Patient Thomas Harrer Infectious Diseases and Immunodeficiency Unit Department of Medicine 3

Düsseldorf Patient: HIV-1-specific Immunity?  Did the new host develop an HIV-1-specific immunity?  High frequencies of HIV-1-specific CTL would indicate active HIV-1 replication and HIV-1 persistence  HIV-1-specific CTL could play an important role in the eradicaton of the HIV-1 reservoir 2

Analysis of HIV-1-specific CTL:  HLA-I type: A2,A24, B7, C7  ELISPOT with PBMC:  PBMC were isolated by Ficoll and rested overnight in R10  ELISPOT with 12 peptides corresponding to known CTL epitopes and two proteins  A2: p17-SL9, RT: IV9, VL9, VL9-V, YV9, PR: KI10-M Nef: PL10, PL10-F.  A24: gp41-EL9, p24-Il8  B7: Nef: FL9, FL9-T, TM9, RL9,  C7: Nef-RY10  20-AA long Gag-Peptides 2 and 5.  Proteins: gp120, p24  positive control: PHA  3

Analysis of HIV-1-specific CTL:  Results:  very weak response to PHA due to immunosuppression  no significant specifc response to peptides  non-significant reaction to Nef7-FL9 No peptide PHA PHA in other patient 4

Analysis of HIV-1-specific CTL: II Analysis of CTL precursor by peptide stimulation  PBMC were stimulated with 6 peptides corresponding to known CTL epitopes in R10 + IL2  Peptides used for stimulation:  P17-SL9, RT IV9, RT YV9, Nef-TM9, gp41-EL9, Nef-RY10  Outgrowing cell lines were tested after two weeks for peptide recognition in a γ -IFN ELISPOT assay 5

Recognition of RT-peptide YV9 by peptide stimulated CTL no peptide RT-YV9 peptide no peptide RT-YV9 peptide Blood from 10/ 2015 Blood from 2/ 2016 6

DP: PBMC: d32 1 – H2O ctgcagctctcattttccata catt aaa 2 – CCR5 wt gatagtcatcttggggctggtcctgcc 3 – CCR5∆32 heterozygous gctgcttgtcatggtcatctgctactcg 4 – CCR5∆32 homoygous ggaatcctaaaaactctgcttcggtgt 5 – PBMC patient cgaaatgagaagaagaggcacaggg 6 RTYV9-CTL line ctgtgaggcttatcttcaccatcatgat 7 –Nef-fl9-line tgtttattttctcttctgggctccctaca acattg 8 – GenLadder 50bp (Genaxxon) 9 – Low Molecular Weight DNA DP RT YV9-CTL line: d32 Ladder ( NEB) ctgcagctctcattttccata catt aaa gatagtcatcttggggctggtcctgcc gctgcttgtcatggtcatctgctactcg The RTYV9 CTL ggaatcctaaaaactctgcttcggtgt cGaaatgagaagaagaggcacagg carry the d32 deletion in CCR5 gctgtgaggcttatcttcaccatcatga ttgtttattttctcttctgggctccctaca acattgtccttctcctgaa The RTYV9 CTL are donor derived

Limiting Dilution Analysis: Frequency of RTYV9-specific precursor CTL Serial dilution of PBMC: 10, 100, 250, 500, 1000, 2000, 4000, 8000, 16000 per well + 50 000 irradiated feeder cells + 25 000 irradiated T2-cells loaded with YV9 peptide in R10/ IL2 24 replicates per dilution Elispot-analysis for peptide recognition after 20 and 23 days. 8

Limiting Dilution Analysis: Frequency of RTYV9-specific precursor CTL % + out of 24 replicates ~ 1: 2000 in PBMC 110 100 90 80 70 60 50 40 37.5 % 30 20 10 0 1 10 100 1000 10000 100000 dilution 2000 4000 9

ELISPOT with freshly isolated PBMC: July 2016  No reversion of tacrolimus induced anergy by IL2 and IL7 (100 ng/ ml each) no gamma-IFN-secreting T-cells  no stimulus  RT YV9  PHA 10

Peptide Stimulation 7/ 2016:  stimulation with RT YV9 and with Nef and Gag peptide pools spanning whole Nef and Gag proteins:  Nef-Pool 20 peptides 20 aa long peptides with a 10 aa overlap  13 Gag pools with 10 peptides each except for pool 13 with 3 peptides (123 peptides, 15 aa long)  Gag pools 10-13 11

Peptide pool 12/ 13 is recognized by CD8+ T-cells Addition of anti-CD8-antibodies blocks T-cell recognition in the ELISPOT assay 12

Epitope mapping peptide pool 12/ 13 1200 1000 800 600 400 200 0 EPID KELYPLASLRS 120 not recognized KE LYPLASLRSL FGN 121 recognized PLASLRSLFGN DPSS 122 not recognized YPL T SLRSLFGN p15-13.2 : weak recognition L Y PLASLRS L A24 epitope Y P LASLRS L B7 epitope 13

The recognized Gag peptide is located in a functional late domain region of p6 late domains promote the release of virus particles from the plasma membrane. The primary Alix binding sequence is located near the C-terminus of p6, between residues 36 and 44 ( 36 YPLASLRSL 44 ) with p6- Y36, L41, and L44 being particularly critical for Gag– Alix binding . 14

Summary I:  The donor developed HIV-1-specific CTL against two functional important CTL epitopes in RT and Gag  These CTL were not detectable in ELISPOT assays with freshly isolated PBMC presumably due to iatrogenic immunosuppression.  The CTL lines showed a strong g-IFN – production despite of prior immunosuppressive therapy 15

Summary II:  This indicates that the new donor developed an immune response to HIV-1 surviving transplantation procedure despite strong immunosuppression  HIV-1-specific CTL could help to decrease viral reservoirs. 16

Acknowledgment Christiane Mummert Silke Bergmann Björn Jensen Guido Kobbe Rolf Kaiser 17

p6 region of its Gag precursor protein, Pr55 Gag . EPID KELYPLASLRS not recognized KEL YPLASLRSL FGN recognized PLASLRSLFGN DPSS not recognized YPL T SLRSLFGN weaker recognition L Y PLASLRS L A24 epitope Y PLTSLRS L B7 epitope The patient recognizes atleast the B7 epitope probably also the A24 epitope. 18