Virus Analysis in Head and Neck and Bladder Cancers Michael - PowerPoint PPT Presentation

Virus Analysis in Head and Neck and Bladder Cancers Michael Parfenov, Ph.D., M.D. Harvard GCC Team 27-28 November, 2012

Viral InfecKons in Carcinogenesis • Head and Neck ¡squamous ¡cell ¡carcinomas ¡ • the sixth ¡most ¡common ¡ cancer worldwide; annual burden of 355,000 deaths and 633,000 incident ¡cases. • 60–80 % of oropharyngeal cancers, ~20% ¡ of oral and laryngeal cancers are caused by human papillomavirus ¡ ( HPV ). • HPV-­‑mediated cancers have significantly improved ¡outcomes . • Bladder cancer • t he second ¡most ¡commonly ¡ occurring genitourinary cancer ¡ in adults. • moderate associa<on ¡ between HPV and BK polyomavirus ¡ infec<on ¡ and tumors. 2

¡Detected ¡Viral ¡Genomes ¡ tumor ¡samples ¡ control ¡samples ¡ virus ¡ Head&Neck ¡ Bladder ¡ Head&Neck ¡ Bladder ¡ (n=113) ¡ (n=105) ¡ (n=113) ¡ (n=105) ¡ HPV ¡type ¡16 ¡ 7 ¡(6.2%) ¡ 2 ¡(1.9%) ¡ 0 ¡ 0 ¡ HPV ¡type ¡33 ¡ 2 ¡(1.8%) ¡ 0 ¡ 1 * ¡(0.8%) ¡ 0 ¡ HPV ¡type ¡90 ¡ 0 ¡ 0 ¡ 1 ¡(0.8%) ¡ 0 ¡ HPV ¡type ¡56 ¡ 0 ¡ 1 ¡(1%) ¡ 0 ¡ 0 ¡ HPV ¡type ¡6 ¡ 0 ¡ 1 ¡(1%) ¡ 0 ¡ 0 ¡ Human ¡herpesvirus ¡1 ¡ 3 ¡(2.7%) ¡ 0 ¡ 1 * ¡(0.8%) ¡ 0 ¡ Human ¡herpesvirus ¡5 ¡ 1 ¡(0.9%) ¡ 2 ¡(1.9%) ¡ 0 ¡ 0 ¡ Human ¡herpesvirus ¡6A ¡ 1 ¡(0.9%) ¡ 0 ¡ 1 * (0.9%) ¡ 0 ¡ Human ¡herpesvirus ¡7 ¡ 1 ¡(0.9%) ¡ 0 ¡ 1 ¡(0.9%) ¡ 0 ¡ BK ¡polyomavirus ¡ 0 ¡ 1 ¡(1%) ¡ 0 ¡ 0 ¡ * ¡has ¡a ¡virus ¡posiKve ¡tumor ¡pair ¡ 3 ¡

HPV ¡ PosiKve ¡samples ¡ cancer ¡ % ¡of ¡covered ¡ number ¡of ¡ HPV ¡ sample ¡ virus ¡ type ¡ viral ¡genome ¡ copies ¡per ¡cell ¡ hpv 16 30 BA-5153-01A hpv 33 20 BB-4225-01A hpv 33 4 CV-6939-01A hpv 16 26 CN-4741-01A 100 hpv 16 5 CV-5971-01A Head & hpv 16 19 BB-4223-01A Neck hpv 16 4 CN-5361-01A hpv 16 1 BA-5559-01A hpv 16 82.9 17 BA-4077-01B hpv 90 31.5 <1 CV-6951-11A hpv 33 13.8 <1 CV-6939-11A <1 hpv 56 48.2 FD-A3B4-01A <1 hpv 16 87.2 BT-A20T-01A Bladder hpv 16 18 GC-A3I6-01A 100 hpv 6 5 FD-A3N6-01A 4 ¡

HPV ¡16 ¡ PosiKve ¡Samples. ¡Genome ¡VisualizaKon ¡ ¡ HPV ¡type ¡16 ¡ genome ¡ BB-­‑4223-­‑ 120x ¡ 01A ¡ CV-­‑5971-­‑ 01A ¡ 60x ¡ 60x ¡ 30x ¡ BA-­‑4077-­‑ 01B ¡ 80x ¡ 80x ¡ 150x ¡ 5 ¡ coverage varies not only across samples but also within the same sample

Virus ¡IntegraKon ¡Events ¡ 6 ¡

DetecKon ¡of ¡IntegraKon ¡Events ¡ Ø HPV ¡ integrates ¡in ¡the ¡gene ¡ TRPC4AP ¡ ¡ chimeric ¡ HPV ¡16 ¡sequence ¡ part ¡of ¡human ¡ TRPC4AP ¡ ¡ part ¡of ¡human ¡ TRPC4AP ¡ ¡ sequence ¡ CV-­‑5971 discordant read -­‑01A ¡ pairs GAGGCTGAGGTGAGAGGACCGCTGGGATTTATTCATTAAAGGCTCTGGGTC ¡ Ø chimeric read 7 ¡

Virus ¡IntegraKon ¡Events ¡in ¡the ¡PosiKve ¡Samples ¡ (examples) ¡ ¡ sample/ ¡ discordant ¡ gene/ ¡ related ¡ gene ¡func<on ¡ to ¡cancer ¡ CNV ¡ virus ¡ read ¡pairs ¡ chr ¡region ¡ 5971-­‑01A ¡ 128 ¡ cell ¡cycle ¡control ¡ ✔ ¡ ✔ ¡ TRPC4AP ¡ hpv16 ¡ DNA ¡repair ¡by ¡homologous ¡ 4077-­‑01B ¡ 120 ¡ RAD51B ¡ ✔ ¡ ✔ ¡ recombinaKon ¡ hpv16 ¡ 38 ¡ KLF5 ¡ transcripKon ¡factor ¡ ✔ ¡ ✔ ¡ 4741-­‑01A ¡ 100kb ¡from ¡ member ¡of ¡the ¡p53 ¡family ¡of ¡ hpv16 ¡ 7 ¡ ✔ ¡ ✔ ¡ TP63 ¡ transcripKon ¡factors ¡ A3I6-­‑01A ¡ 65 ¡ BCL2L1 ¡ anK/pro-­‑apoptoKc ¡regulator ¡ ✔ ¡ ✔ ¡ hpv16 ¡ protein ¡transport ¡ SEC16A ¡ A3B4-­‑01A ¡ 20 ¡ ✔ ¡ ✔ ¡ Notch ¡signaling ¡network ¡ NOTCH1 ¡ hpv56 ¡ A3IT-­‑01A ¡ 5kb ¡from ¡ mitosis ¡regulaKon ¡ 29 ¡ -­‑ ¡ -­‑ ¡ BK ¡ FIGN ¡ ¡ polyomavirus ¡ 4726-­‑01A ¡ 26 ¡ telomeres ¡ HHV ¡6A ¡ 8 ¡

Summary ¡of ¡IntegraKon ¡Events ¡in ¡the ¡ HPV ¡ or ¡ Polyomavirus ¡ posiKve ¡samples ¡ # ¡of ¡integra<on ¡ # ¡of ¡integra<on ¡ sample ¡type ¡ posi<ve ¡samples ¡(%) ¡ nega<ve ¡samples ¡(%) ¡ 10 ¡(71.4%) ¡ 4 ¡(28.6%) ¡ cancer ¡ 0 ¡(0%) ¡ 2 ¡(100%) ¡ control ¡ # ¡of ¡integra<on ¡events ¡ # ¡of ¡integra<on ¡events ¡ forma<on ¡and ¡amplifica<on ¡of ¡ ¡genes ¡associated ¡with ¡cancer ¡ 9 ¡ chimeric ¡episomes ¡ ¡genes ¡without ¡known ¡associa<on ¡with ¡cancer ¡

IntegraKon ¡Events ¡ ¡Accompanied ¡by ¡Possible ¡FormaKon ¡ of ¡Chimeric ¡Episomes ¡ ¡ ¡ 10 ¡

HPV ¡ IntegraKon ¡in ¡ TRPC4AP . ¡Sample ¡CV-­‑5971-­‑01A. ¡ HPV ¡ Genome. ¡ ¡ ¡ integrated ¡region ¡ integrated ¡region ¡ HPV16 ¡ 880 ¡bp ¡ 6,454 ¡bp ¡ 60x ¡ 30x ¡ 60x ¡ CV-­‑5971 -­‑01A ¡ integra<on ¡ integra<on ¡ site ¡ site ¡ site ¡ CV-­‑5971 “ HPV ” ends from -­‑01A ¡ discordant read pairs 11 ¡

HPV ¡ IntegraKon ¡in ¡ TRPC4AP . ¡Sample ¡CV-­‑5971-­‑01A. ¡ Human ¡Genome. ¡ ¡ ¡ 9kb ¡region ¡ chr20 ¡ 33,629,905 ¡bp ¡ 33,638,717 ¡bp ¡ 10x ¡ 10x ¡ 40x ¡ CV-­‑5971 -­‑01A ¡ integra<on ¡ integra<on ¡ site ¡ site ¡ CV-­‑5971 -­‑01A ¡ “human” ends from discordant read pairs TRPC4AP ¡ ¡ 7 th ¡exon ¡ 6 th ¡exon ¡ 12 ¡

HPV ¡ IntegraKon ¡in ¡ TRPC4AP . ¡Sample ¡CV-­‑5971-­‑01A. ¡ Human ¡Genome. ¡ ¡ ¡ chr20 ¡ CV-­‑5971 HPV ¡ sequence ¡ HPV ¡ sequence ¡ -­‑01A ¡ host ¡ TRPC4AP ¡ sequence ¡ ATAATGTCTGACTATATCGCCTTGGGCACCGAAGAAACACAGACGACTA CV-­‑5971 TC ¡ -­‑01A ¡ chimeric reads GAGGCTGAGGTGAGAGGACCGCTGGGATTTATTCATTAAAGGCTCTGGGTC ¡ TRPC4AP ¡ ¡ 7 th ¡exon ¡ 6 th ¡exon ¡ 13 ¡

Suggested ¡Model ¡of ¡the ¡IntegraKon ¡Event ¡ TRPC4AP chr 20 TRPC4AP infected cell with integrated HPV integration 33,629,905 bp 33,638,717 bp TRPC4AP TRPC4AP L1 E6 E7 LCR infected cell TRPC4AP ¡ ¡ chimeric deletion episome Where is the chromosome scar? 14 ¡

Suggested ¡Model ¡of ¡the ¡IntegraKon ¡Event ¡ I. Segregation-based model TRPC4AP L1 LCR E6 E7 TRPC4AP replication TRPC4AP ¡ ¡ + infected cell with integrated HPV excision/circularization TRPC4AP L1 LCR E6 E7 of excised chimeric fragment TRPC4AP TRPC4AP mother cell mitosis TRPC4AP ¡ ¡ TRPC4AP ¡ ¡ TRPC4AP ¡ ¡ TRPC4AP ¡ ¡ episome TRPC4AP ¡ ¡ amplification TRPC4AP TRPC4AP TRPC4AP TRPC4AP TRPC4AP daughter cell 2 daughter cell 1 15 ¡ daughter cell 2 selective advantage

Suggested ¡Model ¡of ¡the ¡IntegraKon ¡Event ¡ II. Rereplication-based model TRPC4AP L1 LCR E6 E7 TRPC4AP start of replication TRPC4AP ¡ ¡ + infected cell with integrated HPV excision/circularization of excised chimeric TRPC4AP fragment reparation rereplication TRPC4AP ¡ ¡ TRPC4AP ¡ ¡ TRPC4AP ¡ ¡ TRPC4AP ¡ ¡ TRPC4AP TRPC4AP TRPC4AP ¡ ¡ TRPC4AP TRPC4AP daughter cell 2 daughter cell 2 TRPC4AP mitosis TRPC4AP TRPC4AP TRPC4AP TRPC4AP TRPC4AP 16 ¡ daughter cell 1

Conclusions ¡ • ¡ The ¡presence ¡of ¡viral ¡sequences ¡and ¡their ¡cellular ¡status ¡can ¡be ¡ detected ¡effecKvely ¡from ¡low ¡pass ¡whole ¡genome ¡sequencing ¡data. ¡ • ¡8% ¡of ¡head&neck ¡and ¡4% ¡of ¡bladder ¡tumors ¡are ¡ HPV ¡ posiKve. ¡ ¡ • ¡9 ¡tumors ¡out ¡of ¡13 ¡ HPV ¡ posiKve ¡samples, ¡as ¡well ¡as ¡1 ¡ BK ¡ polyomavirus , ¡and ¡1 ¡ HHV ¡6A ¡ tumors ¡have ¡at ¡least ¡one ¡integraKon ¡ event. ¡ ¡ • ¡Our ¡results ¡suggest ¡that ¡integraKon ¡events ¡might ¡directly ¡contribute ¡ to ¡carcinogenesis ¡through ¡both ¡viral ¡gene ¡expression ¡and ¡modificaKon ¡ of ¡cellular ¡tumor ¡suppressor ¡or ¡oncogenes. ¡ ¡ ¡ • ¡Based ¡on ¡our ¡data ¡we ¡suggest ¡that ¡in ¡about ¡quarter ¡of ¡all ¡ HPV ¡ integraKon ¡events ¡the ¡integraKon ¡was ¡followed ¡by ¡excision ¡of ¡fused ¡ host ¡and ¡viral ¡regions ¡that ¡form ¡circular ¡minichromosomes ¡that ¡ present ¡in ¡mulKple ¡copies ¡within ¡the ¡cancer ¡cells. 17 ¡

Acknowledgments ¡ Harvard ¡GCC ¡team ¡ Raju ¡KucherlapaK ¡ Lynda ¡Chin ¡ Angela ¡Hadjipanaysis ¡ Alexei ¡Protopopov ¡ Neey ¡Sontoso ¡ John ¡Zhang ¡ Angeliki ¡Pantazi ¡ Sahil ¡Sheth ¡ Peter ¡Park ¡ Henry ¡Song ¡ Semin ¡Lee ¡ Lixing ¡Yang ¡ Jon ¡Seidman ¡ ¡ 18 ¡