switching on the power of e coli
play

SWITCHING)ON)THE) POWER)OF) E.#COLI# - PowerPoint PPT Presentation

Feb 13, 2024 •44 likes •524 views

SWITCHING)ON)THE) POWER)OF) E.#COLI# A"customisable"integrase"switch" Water"Purifica5on" Produc5on"of"clean"water"using"biological"processes"

  1. SWITCHING)ON)THE) POWER)OF) E.#COLI# A"customisable"integrase"switch"

  2. Water"Purifica5on" • Produc5on"of"clean"water"using"biological"processes" • Use"in"agriculture"and"industry" • Possible"source"of"drinking"water"

  3. Our"Mo5va5on" • Bacteria"have"been"engineered"to"uptake"or"produce" different"substances" • Removing"the"bacteria"from"the"liquid"is"challenging"

  4. The"Idea:"Inducing"Gas"Vesicles"

  5. How"Can"We"Induce"Them"To"Float?" • IntegraseIbased"inversion" switch" • Inheritable"and"inducible" switch"mechanism"" " • Enable"flota5on" " "

  6. What"Did"We"Do?" • Public"engagement " • Model" • Swimming"KO" • Plasmid"rescue"of"the"knockouts" • Created"Gvp/promoter"constructs" • Created"an"RFP/GFP"inversion"switch"ac5vated"by"integrase" " "

  7. Glasgow"Science"Centre"2014" • Understanding"the"public’s"view"of"GM"organisms" • Helped"to"focus"the"direc5on"of"the"project" • Allowed"star5ng"point"from"which"to"contact"professionals"in"the"field" • Helped"to"introduce"synthe5c"biology"to"children"in"a"fun"way"

  8. Gate"1"–" Idea" Stage"1"–"Developing" the"Basics" Gate"2"–"Choosing" Applica5on" Stage"2"–"Developing"Final" Technology" Gate"3"–"Suitable"for" Industry?" Stage"3"–" Scaling"Up" Gate"4"–"Considering" the"Future" Industrial"Use"of" Product"

  9. Outreach"Results:"The"Public’s"View" Would"you"be"comfortable" "with"using"our"bacteriaItreated"water?"" n"="100"

  10. What"Did"We"Do?" • Outreach" • Model" • Swimming"KO" • Plasmid"rescue"of"the"knockouts" • Created"Gvp/promoter"constructs" • Created"an"RFP/GFP"inversion"switch"ac5vated"by" integrase" " "

  11. Bacteria"and"Buoyancy" ρ))=)250kg/ m 3)

  12. Run"and"Tumble" Based"on"a"Random"Walk" • Run"Time"="Exponen5al"Distribu5on:" • Mean:"1"second" • Tumble"angle"="Normal" Distribu5on:" • Mean"="68°" • Standard"Devia5on:"36°" ""

  13. Buoyancy"And"Run"And"Tumble" Results":"When"bacteria"swim,"buoyancy"is"not"a"significant"force"–" bacteria"do"not"‘float’."" Conclusion:"floa5ng"requires"knocking"out"swimming.""

  14. What"Did"We"Do?" • Outreach" • Model" • Swimming"KO" • Plasmid"rescue"of"the"knockouts" • Created"Gvp/promoter"constructs" • Created"an"RFP/GFP"inversion"switch"ac5vated"by" integrase" " "

  15. Mo5lity"Genes" • Poten5al"mo5lity"gene"candidates " " Modified"from"Reid"2006"

  16. MotA"Gene"Rescue"of"KO"Strain" WildItype"DS941" DS941"MotA"KO" DS941"MotA"KO"+"promoter/MotA"

  17. MotA"Gene"Rescue"of"KO"Strain" WildItype"DS941" DS941"MotA"KO" DS941"MotA"KO"+"promoter/MotA"

  18. RBS" ACCGAGGAAGCATGAGAATCAAG motB% M K N Q motA% T E E A * motA% motB% motA% motB% ery R"

  19. MotA/MotB"Gene"Rescue"of"KO"Strain" WildItype"DS941" DS941"MotA"KO" DS941"MotA"KO"+"promoter/MotA/MotB"

  20. MotA/MotB"Gene"Rescue"of"KO"Strain" WildItype"DS941" DS941"MotA"KO" DS941"MotA"KO"+"promoter/MotA/MotB"

  21. MotA/MotB"Gene"Rescue"of"KO"Strain"

  22. FliC"Gene"Rescue"of"KO"Strain" WildItype"DS941"" DS941"FliC"KO" DS941"FliC"KO"+"promoter/FliC"

  23. FliC"Gene"Rescue"of"KO"Strain" WildItype"DS941"" DS941"FliC"KO" DS941"FliC"KO"+"promoter/FliC"

  24. FliC"Gene"Rescue"of"KO"Strain" FliC"Mo5lity"Swarm"Assay"" 9" 8" 7" 6" Distance"(cm)" 5" 4" 3" 2" 1" 0" WT" FliC"KO" FliC"+"no"promoter" J23116"+"FliC" J23106"+"FliC"

  25. What"Did"We"Do?" • Outreach" • Model" • Swimming"KO" • Measurement"system" • Created"gas"vesicle"protein"(Gvp)/promoter"constructs" • Created"an"RFP/GFP"inversion"switch"ac5vated"by" integrase" " "

  26. Floa5ng"Efficiency"Measurement"System" Based"on"light"scanering"by"bacteria."" 1. Power"supply" 2. Breadboard"with"2"LEDs" 3. Light"Blocker/Diffuser" Unit" 4. Cuvene"holder"unit" 5. Webcam" 6. Mouldable"Adhesive" (Blutac)" "

  27. Measurement"System:"Results" Average)Speed) TheoreKcal)at) [NaCl]) (μm/s)) 20°C)(μm/s)) 1M" 12.1" 12.0" 3M" 12.7" 9.0" 5M" 8.2" 6.1" 3" • Used"yellow" glass"" Height"(cm)" """""beads"(5μm)" " • Close"to" """"theore5cal" """"speeds"but:" """" Sample)size) was" limited"" 0"

  28. What"Did"We"Do?" • Outreach" • Model" • Swimming"KO" • Measurement"system" • Created"gas"vesicle"protein"(Gvp)/promoter"constructs" • Created"an"RFP/GFP"inversion"switch"ac5vated"by" integrase" " "

  29. Gas"Vesicle"Genes" • GvpA"and"GvpC"from" Planktothrix%rubescens% • GvpA" ! Main"component"of"GV" ! Single"pep5de"wall % • GvpC" ! Strengthens"GvpA"wall" Walsby"1994"

  30. GVP"Construct" • We"added"ribosome"binding"sites"biobricks" to"exis5ng"gvpA"and"gvpC"biobricks" • We"then"made"a"composite"biobrick"with" gvpA"and"gvpC"together."" • We"put"these"under"the"control"of"an" arabinose"inducible"promoter"

  31. Gas"Vesicle"Protein"Expression" Arabinose"I" Arabinose"+" GVP"expression"appears"toxic"

  32. Gas"Vesicle"Protein"Expression" Arabinose"I" Arabinose"+" GVP"expression"appears"toxic"

  33. What"Did"We"Do?" • Outreach" • Model" • Swimming"KO" • Measurement"system" • Created"gas"vesicle"protein"(Gvp)/promoter"constructs" • Created"an"RFP/GFP"inversion"switch"ac5vated"by" integrase" " "

  34. An"IntegraseIBased"Inversion"Switch" Viral"protein"for"genome"integra5on" " Binds"to" a5P "and" a5B% and % it"inverts"the"sequence"between"the"sites"

  35. An"IntegraseIBased"Inversion"Switch" Viral"protein"for"genome"integra5on" " Binds"to" a5P "and" a5B% and % it"inverts"the"sequence"between"the"sites" We"have"created"a"customisable"switch"biobrick"that"anyone"can"use"to"control" genes"of"their"choice.""

  36. Reverse"Ribosome"Binding"Site" Part)Number) Predicted)Binding)Strength)(au)) BBa_B0034) ~20,000" BBa_I742130) ~500" BBa_K1463560) ~12,000"

Recommend

E. coli E. coli Something to think about Something to think about Coeur d Alene Regional

E. coli E. coli Something to think about Something to think about Coeur d Alene Regional

E. coli E. coli Something to think about Something to think about Coeur d Alene Regional Office E. coli situation 13 wadeable streams with E. coli conc. in excess of criteria E. coli TMDLs Hauser Creek < cows

355 views • 16 slides
EMI and RFI 1 Here are some examples of switching power units Variable Frequency Drives

EMI and RFI 1 Here are some examples of switching power units Variable Frequency Drives

EMI and RFI 1 Here are some examples of switching power units Variable Frequency Drives (VFD), Fluorescent Ballasts, Power Supplies and Welders. These are all potential sources of interference on the power lines and can generate both

444 views • 40 slides
Switching in Pharmacy Practice What is Switching Switching is where a prescription that

Switching in Pharmacy Practice What is Switching Switching is where a prescription that

Switching in Pharmacy Practice What is Switching Switching is where a prescription that should be Non Levy has insufficient exemption endorsements made on the back, resulting in a default to levy status. T his means the NHS think we have

341 views • 8 slides
Integration of Routing and Switching Label Switching & IP switching The goal is to avoid

Integration of Routing and Switching Label Switching & IP switching The goal is to avoid

Integration of Routing and Switching Label Switching & IP switching The goal is to avoid executing packet forwarding algorithm for each and every packet and replace it with switching in hardware. The result is faster and less expensive IP

440 views • 23 slides
Robust Power Estimation and Simultaneous Switching Noise Prediction Methods Using Machine Learning

Robust Power Estimation and Simultaneous Switching Noise Prediction Methods Using Machine Learning

Robust Power Estimation and Simultaneous Switching Noise Prediction Methods Using Machine Learning March 20 th , 2019 Robust Simultaneous Switching Noise Prediction for Test using Deep Neural Network Seyed Nima Mozaffari, Bonita Bhaskaran,

969 views • 45 slides
Routing in packet-switching networks Circuit switching vs. Packet switching Most of WANs based on

Routing in packet-switching networks Circuit switching vs. Packet switching Most of WANs based on

Routing in packet-switching networks Circuit switching vs. Packet switching Most of WANs based on circuit or packet switching Circuit switching designed for voice Resources dedicated to a particular call Much of the time a data connection is

358 views • 14 slides
Switching Combinatorial Objects Patric R. J. Osterg ard Department of Communications and

Switching Combinatorial Objects Patric R. J. Osterg ard Department of Communications and

Introduction Switching Error-Correcting Codes Switching Switching Designs Switching Covering Codes Results Switching Combinatorial Objects Patric R. J. Osterg ard Department of Communications and Networking Aalto University P.O. Box

406 views • 36 slides
Venison and E. coli O157 Ian McWatt 26 February 2016, Kingussie E. coli ! 200-250 cases

Venison and E. coli O157 Ian McWatt 26 February 2016, Kingussie E. coli ! 200-250 cases

Venison and E. coli O157 Ian McWatt 26 February 2016, Kingussie E. coli ! 200-250 cases reported per year in Scotland Most patients recover within 10 days Symptoms bloody diarrhoea, abdominal cramps, fever and vomiting

447 views • 15 slides
Development of a Concurrent Dual-Band Switch-Mode Power Amplifier Based on Current- Switching

Development of a Concurrent Dual-Band Switch-Mode Power Amplifier Based on Current- Switching

Development of a Concurrent Dual-Band Switch-Mode Power Amplifier Based on Current- Switching Class-D Configuration Yifei Li, Byron J. Montgomery and Nathan M. Neihart Iowa State University WAMICON 2016 Clearwater Beach, FL Contents

584 views • 21 slides
Circuit and Packet Switching Packet Switching Comparison ITS323: Introduction to Data

Circuit and Packet Switching Packet Switching Comparison ITS323: Introduction to Data

ITS323 Switching Switched Networks Circuit Switching Circuit and Packet Switching Packet Switching Comparison ITS323: Introduction to Data Communications Sirindhorn International Institute of Technology Thammasat University Prepared by

592 views • 30 slides
Switching Algebra Basic postulate: existence of two-valued switching variable that takes two

Switching Algebra Basic postulate: existence of two-valued switching variable that takes two

Switching Algebra and Its Applications 1 Zvi Kohavi and Niraj K. Jha Switching Algebra Basic postulate: existence of two-valued switching variable that takes two distinct values 0 and 1 Switching algebra: algebraic system of set {0,1}, binary

424 views • 18 slides
Reguli KAIST iGEM 2012 Regulation of E.coli Regulation of + E.coli Regu Regu Regulation

Reguli KAIST iGEM 2012 Regulation of E.coli Regulation of + E.coli Regu Regu Regulation

Reguli KAIST iGEM 2012 Regulation of E.coli Regulation of + E.coli Regu Regu Regulation + E.coli li li Prototype Mycobacterium Phage Bxb1, gp35(DNA integrase) & gp47(DNA excisionase) Target att B att P Mycobacterium Phage

1.07k views • 68 slides
Shiga Toxin Producing E. coli Office of Communicable Disease Epi Objectives Shiga toxin E.

Shiga Toxin Producing E. coli Office of Communicable Disease Epi Objectives Shiga toxin E.

Shiga Toxin Producing E. coli Office of Communicable Disease Epi Objectives Shiga toxin E. coli Notifications Process Task Force Initiation/IMT initiation Operations Deactivation Shiga toxin E. Coli Epidemiology E. Coli

173 views • 13 slides
Recent 35t Noise Tests 20160511 - 35t Recent Noise Tests Switching LV power to linear

Recent 35t Noise Tests 20160511 - 35t Recent Noise Tests Switching LV power to linear

Recent 35t Noise Tests 20160511 - 35t Recent Noise Tests Switching LV power to linear supply (check Wiener crate as a noise source) Spectrum analyzer measurements Disabling ADC sampling on subset of channels, check noise on

181 views • 15 slides
Switching Packet Switching Comparison ITS323: Introduction to Data Communications CSS331:

Switching Packet Switching Comparison ITS323: Introduction to Data Communications CSS331:

ITS323/CSS331 Switching Switched Networks Circuit Switching Switching Packet Switching Comparison ITS323: Introduction to Data Communications CSS331: Fundamentals of Data Communications Sirindhorn International Institute of Technology

687 views • 30 slides
1 Message Message Switching Switching Mail delivery G. Bianchi, G. Neglia Packet Switching

1 Message Message Switching Switching Mail delivery G. Bianchi, G. Neglia Packet Switching

432 views • 11 slides
Routing and Switching End-to-end delivery: general concepts Circuit switching [ H a r r i

Routing and Switching End-to-end delivery: general concepts Circuit switching [ H a r r i

IN2140: Introduction to Operating Systems and Data Communication Routing and Switching End-to-end delivery: general concepts Circuit switching [ H a r r i s & E w i n g , 1 9 0 5 ] Principle Connection exists

450 views • 9 slides
STATE-WIDE E. COLI. TMDL AND SOLID WASTE FACILITIES TIM KRAUSE, PE GRANGER WASTE SERVICES

STATE-WIDE E. COLI. TMDL AND SOLID WASTE FACILITIES TIM KRAUSE, PE GRANGER WASTE SERVICES

STATE-WIDE E. COLI. TMDL AND SOLID WASTE FACILITIES TIM KRAUSE, PE GRANGER WASTE SERVICES ESCHERICHIA COLI (E. COLI) BACTERIA SINGLE CELL ORGANISM ANAEROBIC LARGE INTESTINE MOST STRAINS DO NOT CAUSE HUMAN ILLNESS

519 views • 22 slides
Game of life in E coli Conway's Game of Life in E coli Principles of Synthetic Biology David Joy

Game of life in E coli Conway's Game of Life in E coli Principles of Synthetic Biology David Joy

Game of life in E coli Conway's Game of Life in E coli Principles of Synthetic Biology David Joy December 7 th 2015 Game of life in E coli What is Conway's Game of Life? "Gospers glider gun" by Kieff - Own work. Licensed under CC

603 views • 26 slides
Internet architecture Ov Over ervie iew Packet switching over circuit switching

Internet architecture Ov Over ervie iew Packet switching over circuit switching

Internet architecture Ov Over ervie iew Packet switching over circuit switching End-to-end principle and Hourglass design Layering of functionality Portland State University CS 430P/530 Internet, Web & Cloud Systems Pac

396 views • 22 slides
CMOS Inverter: Power Dissipation and Sizing CMOS Inverter Power Dissipation Professor Chris H.

CMOS Inverter: Power Dissipation and Sizing CMOS Inverter Power Dissipation Professor Chris H.

CMOS Inverter: Power Dissipation and Sizing CMOS Inverter Power Dissipation Professor Chris H. Kim University of Minnesota Dept. of ECE chriskim@umn.edu Dynamic Power Consumption Where Does Power Go in CMOS? V DD Switching power i L

183 views • 7 slides
Ethernet OAM and Protection Ethernet OAM and Protection Switching Switching Hiroshi Ohta

Ethernet OAM and Protection Ethernet OAM and Protection Switching Switching Hiroshi Ohta

I nternational Telecom m unication Union ITU-T Ethernet OAM and Protection Ethernet OAM and Protection Switching Switching Hiroshi Ohta Senior Research Engineer, NTT I TU-T W orkshop NGN and its Transport Netw orks Kobe, 2 0 -2 1

547 views • 17 slides
Switching on and switching off Experimental approaches to understanding the impact of ICT

Switching on and switching off Experimental approaches to understanding the impact of ICT

Switching on and switching off Experimental approaches to understanding the impact of ICT use for occupational psychologists: what we can learn from them? Almuth McDowall a.mcdowall@bbk.ac.uk @AlmuthMcDowall Objectives of f this is

246 views • 10 slides
WQCD E. coli proposal for the Basic Standards Rulemaking Hearing January 28, 2010 E. coli

WQCD E. coli proposal for the Basic Standards Rulemaking Hearing January 28, 2010 E. coli

WQCD E. coli proposal for the Basic Standards Rulemaking Hearing January 28, 2010 E. coli workgroup Photo credit: Joe Amon in Denver Post, June 2, 2009 Overview Current standards Proposed changes For June 2010 Basic Standards

331 views • 14 slides

More recommend