Stacking of resistance loci to give full resistance to higher - PowerPoint PPT Presentation

Stacking of resistance loci to give full resistance to higher pathotypes of S. endobioticum June 27 th 2019, Charlotte Prodhomme

Inventory of resistances known so far 1999: 1 st mapping of Sen1 (Hehl et al ., 1999) Adapted from Obidiegwu et al ., 2015 2006: Mapping of Sen1-4 (Brugmans et al ., 2006) 2011: Mapping of several QTLs (Ballvora et al., 2011) 2013: Mapping of several QTLs (Groth et al., 2013) 2015: Mapping of several QTLs (Obidiegwu et al., 2015) 2018: Mapping of Sen2 (Plich et al., 2018) 2018: Mapping of Sen3 (Bartkiewicz et al., 2018 ; Prodhomme et al ., 2019) > Qualitative and quantitative resistance loci identified Sen3 > Broad / specific spectrum of resistance How to use these resistance loci in breeding? Sen2 What is the pathotype R spectrum for Q 2 management?

Population segregating for pathotypes 2, 6 and 18 resistance Resistant parent Susceptible parent Kuba Ludmilla P1, 2, 6, 18 P1 n = 328 Segregating χ2 test χ2 160 ratio significance P2 P6 P18 140 P2 (G1) 1:1 0.30 ns 120 P6 (O1) 1:1 1.48 ns 100 P18 (T1) 1:1 30.49 *** 80 Bimodal distribution of resistance 60 40 to pathotypes 2, 6 and 18 20 > P18 resistance skewed toward 0 susceptibility [1 - 1.5[ [1.5 - 2[ [2 - 2.5[ [2.5 - 3[ [3 - 3.5[ [3.5 - 4[ [4 - 4.5[ [4.5 - 5] S R Glynne-Lemmerzahl 3 Prodhomme et al ., 2019 (Plant Methods)

Principal Component Analysis of phenotypes Individuals fully resistant to P2, P6 and P18 n = 67 Individuals fully susceptible to Individuals fully P2, P6 and P18 resistant to P2 and n = 170 P6, weaker resistance to P18 n = 93 50% 50% 4

Hypothesis about the R loci segregating 1/ There is one gene (or several tightly linked genes) giving full resistance to P2 and P6 and partial resistance to P18  1:1 segregation ratio 2/ One or several other loci are required by the first gene to bring full resistance to P18 50% 50% 5

Strategy to identify the R loci segregating Major gene + P18 R loci P2P6P18 Major gene -R-bulk P18 R loci? Major gene S-bulk P2P6-R- bulk  Whole Genome Sequencing of the three bulks + 2 parents 6

Comparative Subread Sets Analysis = CoSSA R-P2P6- R-bulk S-bulk bulk Whole Genome Whole Genome Sequencing Sequencing K -mer analysis in each sample = quick and easy comparisons ACGTGATGACGTGACGTACCGG… Reads ACGTG CGTGA Subreads = k -mers GTGAT TGATG GATGA ATGAC 7 Prodhomme et al ., 2019 (Plant Methods)

CoSSA method to identify sequence variants linked to the major gene segregating k -mers k -mers k -mers k -mers k -mers k -mers k -mers k -mers k -mers k -mers k -mers k -mers S-bulk Major gene ( + P2P6P18-R-bulk P18 R loci?) Major gene Major gene + P18 R loci? P18 R loci 8

Inheritance of resistance specific variants Ludmilla Kuba Mapping of the subreads to the potato reference genome 9

Subread mapping reveals a single locus for P2, P6, P18 resistance a) R-genes in the reference genome (Jupe et al ., 2013) b) R-bulk specific k -mers from Kuba c) R-bulk specific k -mers from Ludmilla d) R-bulk specific k -mers from both parents 10 Prodhomme et al ., 2019 (Plant Methods)

Design of KASP markers to validate Sen3 Jupe et al ., 2013 11 Prodhomme et al ., 2019 (Plant Methods)

Effect of chr11_1519485 on P18 resistance S R P2 P6 P18 12

CoSSA method to identify sequence variants linked to the P18 R loci segregating R-P2P6-Bulk R-P2P6-Bulk R-P2P6-bulk Major gene + P2P6P18-R-bulk P18 R loci Major gene Major gene + P18 R loci 13

Inheritance of resistance specific variants Ludmilla Kuba Mapping of the subreads to the potato reference genome 14

Subread mapping reveals several loci for P18 resistance a a) R-genes in the reference genome (Jupe et al ., 2013) b b) R-bulk specific k -mers from Kuba c) R-bulk specific k -mers from Ludmilla c d) R-bulk specific k -mers from both parents d 15

Validation experiment with KASP markers Pathotype 2 Pathotype 6 Pathotype 18 Chr02_30 ns ns ns Chr02_32 ns ns ns Chr05_8 ns ns ns Chr06_25 ns ns ns Chr07_10 ns ns ns Chr07_41 ns ns ns Chr08_44 ns ns 0.03401 Chr08_45 ns ns 0.04718 Chr11_1259552 < 2.2e-16 < 2.2e-16 < 2.2e-16 Sen3 Chr11_1519485 < 2.2e-16 < 2.2e-16 < 2.2e-16 Chr11_1666090 < 2.2e-16 < 2.2e-16 < 2.2e-16 Interaction Sen3 * chr8  p -value = 0.00974** 16

Effect of the chr8 locus on P18 resistance Ludmilla S Pathotype 18 resistance Kuba 3 CNL clusters: - Clusters 59, 60 and 61 - Rpi-blb1 , Rpi-pta1 , Rpi-sto1 R No QTL Sen3 Sen3 + chr8 chr8 Jupe et al ., 2013 17

One isolate = several genotypes › Mitochondrial genome sequencing revealed an intra- isolate variation. › Higher diversity observed for isolates from P8, P18, P38. > Intra-isolate diversity can explain the strong or weak effect of the R loci mapped van de Vossenberg et al ., 2018 18

Use of only one R gene ( Sen3 ) Pathotype 18 Incomplete population resistance Sen3 SenChr8 New pathotype population AvrSen3 AvrSen Chr8 19

Use of only one R gene ( Sen3 ) Susceptibility Sen3 SenChr8 New pathotype population AvrSen3 AvrSen Chr8 20

Stack of R genes ( Sen3 + chr8) Complete resistance Sen3 SenChr8 Pathotype 18 population AvrSen3 AvrSen Chr8 21

Take home messages  Diversity of S. endobiodicum populations causal to partial resistance: ● Complex populations can only be contained by broad spectrum R genes or R gene stacks  More research should be performed on identifying R loci to less frequent S. endo genotypes: ● How to identify such loci? How to design diagnostic markers for a use in MAS? 22

Phenotype the segregating population with the “trained” pathotype Use the pathotype 18 population that was multiplied on Sen3 genotypes  enrichment of the S. endobioticum genotypes recognised by the chromosome 8 QTL Re-phenotype the K x L population with the “trained” P18 Stronger effect of chr8 QTL / weaker effect of Sen3 on P18 resistance  unambiguous phenotypes  mapping and fine-mapping 23

Acknowledgements Wageningen University and Consortium Partners Research Plant Breeding Jack Vossen Herman van Eck Richard Visser Danny Esselink TKI T&U Gert van Arkel Linda Kodde Theo Borm Dirk-Jan Huigen Marjan Bergervoet Biointeractions This project is financially supported by the Dutch Topsector Horticulture & Starting Materials. Within the Topsector, private industry, Theo vd Lee knowledge institutes and the government are working together on innovations for sustainable production of safe and healthy food and the Bart vd Vossenberg development of a healthy green environment. Thank you for your attention 24