Smoking Cessation Research: From the Laboratory to Health - PowerPoint PPT Presentation

Smoking Cessation Research: From the Laboratory to Health Communication Caryn Lerman, Ph.D. Mary W. Calkins Professor Department of Psychiatry University of Pennsylvania clerman@mail.med.upenn.edu

Overview of Lecture • Genetics and Smoking Cessation -basic principles -research examples -role of health communication research • Motivating Smokers to Seek Treatment -anti-tobacco PSAs: message design and evaluation

Why do people smoke? To extract nicotine, the addictive chemical in tobacco Why don’t people quit? Because nicotine addiction is a brain disease, resulting from changes in brain structure and function following chronic nicotine exposure.

Nicotine Dependence Treatment • FDA-approved medications-- NRT, bupropion, and varenicline-- are efficacious. • BUT, as many as 70% of smokers do not maintain abstinence with these medications • There is a need to develop new treatment models that can be readily translated to the clinical setting to maximize the effectiveness of nicotine dependence treatment.

No response Adverse event Response

Genetic Variation in Drug Metabolizing Enzymes and Drug Targets Influences Therapeutic Outcomes

How does this work? Chromosomes 5’U Exon1 Exon2 Exon3 Exon4 Exon5 Exon6 Exon7 Exon8 3’U Gene CGAGTCGTACCGTAGCGGCGAT GCTCAGCATGGCATCGCCGCTA Base pairs CGAGTCGTACTGTAGCGGCGAT GCTCAGCATGACATCGCCGCTA SNP = single nucleotide polymorphism

Genetic Variation in Nicotine Metabolizing Enzymes and Response to NRT

Open Label Trial of TN vs. NS (n=599) Orientation & Screening Pre-treatment Assessment & Genotyping NS + 7 sessions TN+ 7 sessions group counseling group counseling 95% retention rate Follow-Up: EOT, 6-months, and 12-months

Nicotine Metabolic Profile Benowitz et al NICOTINE-1’-N-OXIDE NORNICOTINE NICOTINE 0.4% 9.8% 4.4% NICOTINE GLUCURONIDE NICOTINE 4.2% CYP2A6 ~ 80% TRANS-3’- COTININE TRANS-3’- HYDROXYCOTININE COTININE HYDROXYCOTININE 13.0% 33.6% COTININE TRANS-3’ GLUCURONIDE HYDROXYCOTININE COTININE-N-OXIDE NORCOTININE GLUCURONIDE 12.6% 2.4% 7.4% 2%

Genetically Slow Metabolizers have higher nicotine on the patch Nicotine Patch Usage Plasma Nicotine ± SD (# days worn) (ng/mL) 30 7.5 p =0.02 7.0 20 (5) (5) 6.5 10 (118) (125) Malaiyandi et al, Mol Psychiatry 2006 6.0 0

Genetically Slow Metabolizers have lower usage & equal nicotine on spray Nicotine Spray Usage Plasma Nicotine ± SD (doses/day) (ng/mL) 30 25 (98) p <0.02 20 15 (109) (7) (11) 10 5 Malaiyandi et al, Mol Psychiatry 2006 0 -5

Genetically Slow Metabolizers have lower 3HC/COT ratios 1.8 1.6 Malaiyandi et al, p<0.01 Mol Psychiatry 2006 1.4 3HC/COT 1.2 1.0 0.8 0.6 0.4 0.2 0.0 Normal Intermediate Slow (n=247) (n=49) (n=14) Genotype Group

Treatment Levels of Plasma Nicotine By Nicotine Metabolite Ratio and Treatment (Abstainers only, n=333 out of 480) Plasma Nicotine 25 Lerman et al, Clinical Pharm. Therapeutics, Patch 2006 Spray 20 15 10 5 0 1st Qrtl 2nd Qrtl 3rd Qrtl 4th Qrtl Slow Fast 3-HC: Cotinine Ratio in Quartiles

Smoking Cessation Rates by Nicotine Metabolite Ratio and Treatment n=480 % Quit Transdermal Patch Nasal Spray 50 End of treatment 45 6-month 40 35 30 25 20 15 10 5 0 1st Qrtl 2nd Qrtl 3rd Qrtl 4th Qrtl 1st Qrtl 2nd Qrtl 3rd Qrtl 4th Qrtl Slow Fast 3-HC: Cotinine Ratio in Quartiles

Summary • Genetically faster metabolizers of nicotine smoke more and are less likely to quit • A blood test might be used in the future to screen smokers to determine likely success with a standard dose of nicotine patch, and/or need for a higher dose or alternate treatment.

Evaluating Anti-Smoking PSAs Caryn Lerman, Ph.D. Mary W. Calkins Professor Deputy Director, Abramson Cancer Center Supported by an NCI Center of Excellence in Cancer Communication Research Grant and a Transdisciplinary Tobacco Use Research Center grant at the University of Pennsylvania

How do We Motivate Smokers to Seek Treatment? Mass Media Smoking Campaigns • Mass media anti-smoking campaigns have had some promising results, but outcomes have been inconsistent. • To develop more effective anti-smoking PSAs, there is a need for theory-driven experimental research on PSA effectiveness.

PSA Attributes MESSAGE SENSATION VALUE: Formal features of the PSA, such as pace of cuts and edits, music, intensity. ARGUMENT QUALITY: Content feature of the PSA—specifically, the quality of the center argument (reason) for not smoking.

Overarching Conceptual Model Socio-environmental Sensation-seeking Influences/Constraints Norms * Arg. Arousal/ Beliefs: Affect * norms PSA Intentions Behavior Attitudes conseq. Processing images efficacy Recall * MSV Self- efficacy/Skills Smoking status/ past behavior * Priming Theory Activation theory Integrative theory/TRA

Project Aims 1. To test the main and interacting effects of PSA message sensation value (MSV) and argument quality on smoking cessation treatment- seeking. Hyp: Based on ELM, high MSV may distract and reduce counter-arguing; thus, effects of argument strength may be weaker for high MSV ads Alt Hyp: Based on activation theory, high MSV may lead to greater processing of arguments; thus, effects of argument strength may be stronger for high MSV ads 2. To explore mediating cognitive mechanisms of PSA effects.

Study Design & Procedures Argument Quality Baseline Questionnaire Weak Strong MSV View PSAs (as a set of 4) N=50 N=50 Low •Psychophysiology assessment Outcome Measures N=50 N=50 High •Beliefs, attitudes, intentions, etc View PSAs (individually) •Thought listing, processing,effectiveness Recall Measures

Physiologic Sensor Placement corrugator (EMG) (hypo)thenar eminence (SC) zygomatic (EMG) clavicle+forearm (HR)

Measures Baseline Covariates/Moderators • Demographics, smoking history • Sensation-seeking, need for cognition Mediating Variables • Arousal/Attention (physiological) • Cognitive and emotional processing • Recall Outcome Variables • Attitudes, beliefs, social norms • Behavioral control/self efficacy • Behavioral intention • Calling the quit line

Phase I: PSA Rating and Selection 1. Categorizing Topics 2. Evaluating Message Sensation Value 3. Evaluating Arguments

PSA Categorization • 569 smoking-related PSAs were categorized based on topic • Selection based on: Audience Target – Adults Behavioral Target – Quitting smoking/seeking treatment (second hand smoke-focus excluded)

Categorization of PSAs � Provoke Seeking Treatment/Quitting � Knowledge About Smoking Manipulation by Tobacco Companies Say No to Smoking/ Refusal Skills Promote Non-Smoking (Positive Consequences) Testimonials Negative Consequences – General Negative Consequences – Disease and Death Negative Consequences – Endangers Others Negative Consequences – Cosmetic � Negative Consequences – Any

Reliability of Categorization 2 CECCR and 2 TTURC raters categorized the PSAs: - TTURC raters were >90% in agreement with Annenberg ratings - TTURC raters were >95% in agreement with each other - Overall Kappa = 0.89, p<.001

Target Audience (adults) # of PSAs (n=99) 70 60 50 40 30 20 42 59 15 10 0 Promote Tx-Seeking Neg. Conseq. (any) Knowledge about smoking

2. Evaluating Message Sensation Value PSAs differ in format, intensity and audiovisual features. Message Sensation Value (MSV) is a measure of these attributes. Perceived Message Sensation Value (PMSV) is the subjective report of the MSV features. MSV is coded for visual, audio and content dimensions. Morgan, Palmgreen, Stephenson, Hoyle, Lorch: J of Comm, 2003.

MSV Scoring (Kentucky/rPMSV Morgan et al) Category Item Scoring Length Time (seconds) Animation 0/1 Cuts 0=1-6; 1=7-14; 2=15+ Visual Edits 0=1-6; 1=7-14; 2=15+ Faces count Special Visual Effect 0/1 Highlighted items p<.1 for Slow Motion 0/1 association with pMSV Fast Motion 0/1 Unusual Colors 0/1 Intense Moments 0/1

MSV Scoring (Kentucky/rPMSV Morgan et al) Category Item Scoring Sound Saturation 0/1 Music 0/1 Audio Sound Effects 0/1 Slow Voice 0/1 Fast Voice 0/1 Acted out/ Talking Head 1 vs 0 Narrative 0/1 Content Unexpected Format 0/1 Surprise/Twist Ending 0/1 Celebrity 0/1

Distribution of PSAs by MSV score (N=99) 40 Mean = 1.6465 Std. Dev. = 1.29609 N = 99 30 Frequency 20 10 0 0.00 1.00 2.00 3.00 4.00 5.00 rPMSV Inter-rater reliability of MSV scoring (2 raters): MSV scores from subset of 45 of 99 PSAs: Kendall’s Tau = 0.906, p<0.001.