Sequence Alignment Mark Voorhies 4/24/2012 Mark Voorhies Sequence - PowerPoint PPT Presentation

Nov 24, 2023 •301 likes •491 views

Sequence Alignment Mark Voorhies 4/24/2012 Mark Voorhies Sequence Alignment Exercise: Transforming sequences 1 Write a function to return the antisense strand of a DNA Why compare sequences? Mark Voorhies Sequence Alignment Why compare

Sequence Alignment Mark Voorhies 4/24/2012 Mark Voorhies Sequence Alignment
Exercise: Transforming sequences 1 Write a function to return the antisense strand of a DNA
Why compare sequences? Mark Voorhies Sequence Alignment
Why compare sequences? To find genes with a common ancestor To infer conserved molecular mechanism and biological function To find short functional motifs To find repetitive elements within a sequence To predict cross-hybridizing sequences (e.g. in microarray design) To predict nucleotide secondary structure Mark Voorhies Sequence Alignment
Whiteboard Image Mark Voorhies Sequence Alignment
Nomenclature Homologs heritable elements with a common evolutionary origin. Mark Voorhies Sequence Alignment
Nomenclature Homologs heritable elements with a common evolutionary origin. Orthologs homologs arising from speciation. Paralogs homologs arising from duplication and divergence within a single genome. Mark Voorhies Sequence Alignment
Nomenclature Homologs heritable elements with a common evolutionary origin. Orthologs homologs arising from speciation. Paralogs homologs arising from duplication and divergence within a single genome. Xenologs homologs arising from horizontal transfer. Onologs homologs arising from whole genome duplication. Mark Voorhies Sequence Alignment
Dotplots 1 Unbiased view of all ungapped
Dotplots 1 Unbiased view of all ungapped
Types of alignments Global Alignment Each letter of each sequence is aligned to a letter or a gap ( e.g. , Needleman-Wunsch) Local Alignment An optimal pair of subsequences is taken from the two sequences and globally aligned ( e.g. , Smith-Waterman) Mark Voorhies Sequence Alignment
Exercise: Scoring an ungapped alignment s =
Exercise: Scoring an ungapped alignment s =
Exercise: Scoring an ungapped alignment s =
Exercise: Scoring an ungapped alignment s =
Exercise: Scoring a gapped alignment 1 Given two equal length gapped sequences (where “-”
Exercise: Scoring a gapped alignment 1 Given two equal length gapped sequences (where “-”
Homework 1 Read chapter 3 of the BLAST book (Sequence Alignment).

Recommend

CSE 421 Algorithms Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming

CSE 421 Algorithms Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming Algorithm 2 Sequence Alignment Goal: position characters in two strings to best line up identical/similar ones with one another We can do

473 views • 28 slides

CSE 427 Comp Bio Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming

CSE 427 Comp Bio Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming Algorithm 2 Sequence Alignment Goal: position characters in two strings to best line up identical/similar ones with one another We can do this

941 views • 56 slides

Sequence Alignment Sequence Alignment AGGCTATCACCTGACCTCCAGGCCGATGCCC

Sequence Alignment Sequence Alignment AGGCTATCACCTGACCTCCAGGCCGATGCCC TAGCTATCACGACCGCGGTCGATTTGCCCGAC -AGGCTATCACCTGACCTCCAGGCCGA--TGCCC--- || ||||||| |||| | || ||| ||||| TAG-CTATCAC--GACCGC--GGTCGATTTGCCCGAC Distance from sequences

767 views • 62 slides

This week CSE 527 Sequence alignment Computational Biology More sequence alignment

This week CSE 527 Sequence alignment Computational Biology More sequence alignment Autumn 2007 Weekly bio interlude - DNA replication Lectures 2-3 Sequence Alignment; DNA Replication 1 Sequence Alignment What Why

492 views • 15 slides

CSE 427 Computational Biology Winter 2008 Sequence Alignment; DNA Replication 1 Sequence

CSE 427 Computational Biology Winter 2008 Sequence Alignment; DNA Replication 1 Sequence Alignment Part I Motivation, dynamic programming, global alignment 3 Sequence Alignment What Why A Simple Algorithm Complexity

892 views • 56 slides

Sequence Alignment (chapter 6) The biological problem l Global alignment l Local alignment l

Sequence Alignment (chapter 6) The biological problem l Global alignment l Local alignment l Multiple alignment l Introduction to bioinformatics, Autumn 2006 22 Background: comparative genomics Basic question in biology: what properties

934 views • 44 slides

CSCI 490 Bioinformatics Part II: Pair-wise Sequence Alignment Outline Whats the

CSCI 490 Bioinformatics Part II: Pair-wise Sequence Alignment Outline Whats the biological problem Algorithm issues Intro to dynamic programming Global sequence alignment Local sequence alignment More efficient

2.09k views • 163 slides

CSE 421 Midterm Scores Mean 83 Sigma 11 1 CSE 421 Algorithms Sequence Alignment 1 Sequence

CSE 421 Midterm Scores Mean 83 Sigma 11 1 CSE 421 Algorithms Sequence Alignment 1 Sequence Alignment Goal: position characters in strings so they best line up with one another We can do this via Dynamic Programming 2 What is an

475 views • 31 slides

Sequence Alignment: Mo1va1on and Algorithms Mo1va1on and

Sequence Alignment: Mo1va1on and Algorithms Mo1va1on and Introduc1on Importance of Sequence Alignment For DNA, RNA and amino acid sequences, high sequence

1k views • 62 slides

Sequence Alignment (chapter 6) p The biological problem p Global alignment p Local alignment p

Sequence Alignment (chapter 6) p The biological problem p Global alignment p Local alignment p Multiple alignment 200 Local alignment: rationale p Otherwise dissimilar proteins may have local regions of similarity -> Proteins may share a

980 views • 56 slides

Sequence comparison: Sequence comparison: Significance of alignment scores

Sequence comparison: Sequence comparison: Significance of alignment scores http://faculty.washington.edu/jht/GS559_2014/ Genome 559: Introduction to Statistical and Computational Genomics d C i l G i Prof. James H. Thomas Unscaled EVD

781 views • 13 slides

CSCI 490 Bioinformatics Multiple Sequence Alignment Multiple Sequence Alignment Motivation:

CSCI 490 Bioinformatics Multiple Sequence Alignment Multiple Sequence Alignment Motivation: A faint similarity between two sequences becomes very significant if present in many sequences Definition Given N sequences x 1 , x 2

626 views • 30 slides

CSE421 Algorithms Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming

CSE421 Algorithms Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming Algorithm 8 Sequence Similarity: What G G A C C A T A C T A A G T C C A A T 9 Sequence Similarity: What G G A C C A T A C T A A G | : | : |

689 views • 26 slides

CSE 427 Comp Bio Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming

CSE 427 Comp Bio Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming Algorithm 2 Sequence Similarity: What G G A C C A T A C T A A G T C C A A G 3 Sequence Similarity: What G G A C C A T A C T A A G | | |

644 views • 51 slides

Sequence Alignment Mark Voorhies 5/29/2013 Mark Voorhies Sequence Alignment Exercise: Scoring

Sequence Alignment Mark Voorhies 5/29/2013 Mark Voorhies Sequence Alignment Exercise: Scoring an ungapped alignment Given two sequences and a scoring matrix, find the offset that yields the best scoring ungapped alignment. Mark Voorhies

425 views • 5 slides

Sequence Alignment Mark Voorhies 5/20/2015 Mark Voorhies Sequence Alignment Exercise: Scoring

Sequence Alignment Mark Voorhies 5/20/2015 Mark Voorhies Sequence Alignment Exercise: Scoring an ungapped alignment Given two sequences and a scoring matrix, find the offset that yields the best scoring ungapped alignment. Mark Voorhies

406 views • 29 slides

Sequence Alignment Mark Voorhies 4/12/2018 Mark Voorhies Sequence Alignment Exercise: Scoring

Sequence Alignment Mark Voorhies 4/12/2018 Mark Voorhies Sequence Alignment Exercise: Scoring an ungapped alignment Given two sequences and a scoring matrix, find the offset that yields the best scoring ungapped alignment. Mark Voorhies

617 views • 38 slides

HMMs for Pairwise Sequence Alignment based on Ch. 4 from Biological Sequence Analysis by R.

0. HMMs for Pairwise Sequence Alignment based on Ch. 4 from Biological Sequence Analysis by R. Durbin et al., 1998 Acknowledgement: M.Sc. student Oana R at oi [ B. subtilis PRPP synthase ] 1. PLAN 1 How to build a pair HMM for

590 views • 36 slides

Pairwise Sequence Alignment based on Ch. 2 from Biological Sequence Analysis by R. Durbin et

0. Pairwise Sequence Alignment based on Ch. 2 from Biological Sequence Analysis by R. Durbin et al., 1998 Acknowledgements: M.Sc. student Oana R at oi M.Sc. student Diana Popovici [ Sperm whale myoglobin (2lh7) and Lupin leghaemoglobin

1.29k views • 66 slides

Sample Complexity of Algorithm Configuration for Sequence Alignment Travis Dick Nina Balcan Dan

Sample Complexity of Algorithm Configuration for Sequence Alignment Travis Dick Nina Balcan Dan DeBlasio Carl Kingsford Tuomas Sandholm Ellen Vitercik Sequence alignment Goal: Line up pairs of strings ( DNA, RNA, protein, ) Uncover

946 views • 39 slides

A Compressing Method for Genome Sequence Cluster using Sequence Alignment Kwang Su Jung 1 , Nam

A Compressing Method for Genome Sequence Cluster using Sequence Alignment Kwang Su Jung 1 , Nam Hee Yu 1 , Seung Jung Shin 2 , Keun Ho Ryu 1 1 Database/Bioinformatics Laboratory, Chungbuk National University, Korea 2 Divison of IT, Hansei

318 views • 6 slides

Efficient Parallel Implementations of Multiple Sequence Alignment Using BSP/CGM Model Jucele F.

Introduction Multiple Sequence Alignment Distributed Memory Shared Memory Computational Results Conclusions and Future Work Efficient Parallel Implementations of Multiple Sequence Alignment Using BSP/CGM Model Jucele F. A. Vasconcellos,

459 views • 21 slides

Multiple Sequence Alignment based on Ch. 6 from Biological Sequence Analysis by R. Durbin et

0. Multiple Sequence Alignment based on Ch. 6 from Biological Sequence Analysis by R. Durbin et al., 1998 Acknowledgements: M.Sc. student Diana Popovici M.Sc. student Oana R at oi [ MHC class I with peptide ] MHC = Major

726 views • 51 slides

Multiple Sequence Alignment using Profile HMM based on Chapter 5 and Section 6.5 from

0. Multiple Sequence Alignment using Profile HMM based on Chapter 5 and Section 6.5 from Biological Sequence Analysis by R. Durbin et al., 1998 Acknowledgements: M.Sc. students Beatrice Miron, Oana R at oi, Diana Popovici 1. PLAN

728 views • 36 slides