segment based multiple sequence alignment
play

Segment-based Multiple Sequence Alignment T . Rausch, A.-K. Emde, - PowerPoint PPT Presentation

Mar 07, 2024 •13 likes •423 views

Knut Reinert May 2009 Segment-based Multiple Sequence Alignment T . Rausch, A.-K. Emde, D. Weese, A. Dring, C. Notredame and K. Reinert Knut Reinert 25.5.2009 (based on slides from Tobias Rausch) Algorithmische Bioinformatik Monday, May

  1. Knut Reinert May 2009 Segment-based Multiple Sequence Alignment T . Rausch, A.-K. Emde, D. Weese, A. Döring, C. Notredame and K. Reinert Knut Reinert 25.5.2009 (based on slides from Tobias Rausch) Algorithmische Bioinformatik Monday, May 25,

  2. Tobias Rausch, Agenda September 2008 • Alignment Graph • Multiple Sequence Alignment Algorithm • Implementation and Results Algorithmische Bioinformatik Monday, May 25,

  3. Tobias Rausch, Segment-based Alignment Graph September 2008 • Alignment Matrix • Alignment Graph Algorithmische Bioinformatik Monday, May 25,

  4. Tobias Rausch, Applications September 2008 • Protein Alignment Algorithmische Bioinformatik Monday, May 25,

  5. Tobias Rausch, Applications September 2008 • Protein Alignment • Genome Comparison Algorithmische Bioinformatik Monday, May 25,

  6. Tobias Rausch, Applications September 2008 • Protein Alignment • Genome Comparison • Multi-Read Alignment Algorithmische Bioinformatik Monday, May 25,

  7. Tobias Rausch, Methods September 2008 Alignment Algorithm Algorithmische Bioinformatik Monday, May 25,

  8. Tobias Rausch, Components of the Algorithm September 2008 Algorithmische Bioinformatik Monday, May 25,

  9. Tobias Rausch, Components of the Algorithm September 2008 Algorithmische Bioinformatik Monday, May 25,

  10. Tobias Rausch, Segment-Match Generation September 2008 • Global alignments [NW70, Got82] Algorithmische Bioinformatik Monday, May 25,

  11. Tobias Rausch, Segment-Match Generation September 2008 • Global alignments [NW70, Got82] • Local alignments [SW81, WE87] Algorithmische Bioinformatik Monday, May 25,

  12. Tobias Rausch, Segment-Match Generation September 2008 • Global alignments [NW70, Got82] • Local alignments [SW81, WE87] • Variants: Overlap, Banded Algorithmische Bioinformatik Monday, May 25,

  13. Tobias Rausch, Segment-Match Generation September 2008 • Global alignments [NW70, Got82] • Local alignments [SW81, WE87] • Variants – Overlap alignments – Banded alignments • Others: – Longest-common subsequence [JV92] S 0 :XMJYAUZ S 1 :MZJAWXUE Algorithmische Bioinformatik Monday, May 25,

  14. Tobias Rausch, Segment-Match Generation September 2008 • Global alignments [NW70, Got82] • Local alignments [SW81, WE87] • Variants – Overlap alignments – Banded alignments • Others: – Longest-common subsequence [JV92] S 0 :XMJYAUZ S 1 :MZJAWXUE Algorithmische Bioinformatik Monday, May 25,

  15. Tobias Rausch, Segment-Match Generation September 2008 • Global alignments [NW70, Got82] • Local alignments [SW81, WE87] • Variants – Overlap alignments – Banded alignments • Others: – Longest-common subsequence [JV92] – External segment-matches • MUMmer, BLAST hits • External alignments Algorithmische Bioinformatik Monday, May 25,

  16. Tobias Rausch, Collect all Segment Matches September 2008 IPPQFDFRDEYPQC--VKP IPEYVD----WRQKGAVTP VKP IPPQFD VTP IPEYVD YPQC WRQK Algorithmische Bioinformatik Monday, May 25,

  17. Tobias Rausch, Segment Match Refinement September 2008 Algorithmische Bioinformatik Monday, May 25,

  18. Tobias Rausch, Segment Match Refinement September 2008 Algorithmische Bioinformatik Monday, May 25,

  19. Tobias Rausch, Segment Match Refinement September 2008 [HHR02, REW+08] Algorithmische Bioinformatik Monday, May 25,

  20. Tobias Rausch, Alignment Graph Construction September 2008 Algorithmische Bioinformatik Monday, May 25,

  21. Tobias Rausch, Alignment Graph Construction September 2008 • Only a subset of all the edges constitutes a valid alignment Algorithmische Bioinformatik Monday, May 25,

  22. Tobias Rausch, Alignment Graph Construction September 2008 • Only a subset of all the edges constitutes a valid alignment • Select the alignment edges (trace edges) of maximum weight = Maximal Trace [SK83,Kec93] Algorithmische Bioinformatik Monday, May 25,

  23. Tobias Rausch, Consistency Extension September 2008 GARFIELDTHELASTFA-TCAT GARFIELDTHE----FASTCAT --------THE----FA-TCAT [NHH00] Algorithmische Bioinformatik Monday, May 25,

  24. Tobias Rausch, Consistency Extension September 2008 GARFIELDTHELASTFATCAT GARFIELDTHEFAS---TCAT --------THEFA----TCAT Algorithmische Bioinformatik Monday, May 25,

  25. Tobias Rausch, Consistency Extension September 2008 GARFIELDTHE LASTFATCAT GARFIELDTHE FAS---TCAT --------THE FA----TCAT Algorithmische Bioinformatik Monday, May 25,

  26. Tobias Rausch, Consistency Extension September 2008 GARFIELDTHELASTFA TCAT GARFIELDTHEFAS--- TCAT --------THEFA---- TCAT Algorithmische Bioinformatik Monday, May 25,

  27. Tobias Rausch, Consistency Extension September 2008 GARFIELDTHE LASTFA TCAT GARFIELDTHE FAS--- TCAT --------THE FA---- TCAT Algorithmische Bioinformatik Monday, May 25,

  28. Tobias Rausch, Consistency Extension September 2008 • Increase the weight of clique edges [NHH00] Algorithmische Bioinformatik Monday, May 25,

  29. Tobias Rausch, Consistency Extension September 2008 GARFIELDTHELASTFA-TCAT GARFIELDTHE----FASTCAT --------THE----FA-TCAT Algorithmische Bioinformatik Monday, May 25,

  30. Tobias Rausch, Consistency Extension September 2008 GARFIELDTHE LASTFA- TCAT GARFIELDTHE ----FAS TCAT --------THE ----FA- TCAT Algorithmische Bioinformatik Monday, May 25,

  31. Tobias Rausch, Distance Matrix September 2008 Algorithmische Bioinformatik Monday, May 25,

  32. Tobias Rausch, Guide Tree September 2008 Algorithmische Bioinformatik Monday, May 25,

  33. Tobias Rausch, Graph-based Progressive Alignment September 2008 • Progressive alignment – Aligns strings / profiles of vertices – Heaviest common subsequence algorithm [JV92] Algorithmische Bioinformatik Monday, May 25,

  34. Tobias Rausch, Graph-based Progressive Alignment September 2008 Algorithmische Bioinformatik Monday, May 25,

  35. Tobias Rausch, Configurable September 2008 Algorithmische Bioinformatik Monday, May 25,

  36. Tobias Rausch, Implementation and Results September 2008 Implementation and Results Algorithmische Bioinformatik Monday, May 25,

  37. Tobias Rausch, Results September 2008 Deep Alignment Protein Alignment DNA and Multi-Read Genome Alignment Alignment Algorithmische Bioinformatik Monday, May 25,

  38. Tobias Rausch, Results September 2008 • BAliBASE 3.0 (Protein Benchmark) RV11 RV12 RV20 RV30 RV40 RV50 CPU time (s) M-Coffee 42.74 85.86 44.78 56.1 55.8 54.69 27,730 Our Tool 46.89 86.16 46.56 58.9 62.39 58.94 12,455 • Alignment of 6 adenoviruses (DNA) Avg. Identity CPU time (s) DIALIGN-T 48% 1259 MAFFT 62% 118 MUSCLE 38% 673 Our Tool 65% 328 • More detailed results are in the paper Algorithmische Bioinformatik Monday, May 25,

  39. Tobias Rausch, Part of SeqAn September 2008 • Extendable – Add your own algorithm www.seqan.de Algorithmische Bioinformatik Monday, May 25,

  40. Tobias Rausch, Thank You for Your Attention! September 2008 Visit: www.seqan.de/projects/msa.html Andreas Anne-Katrin Cedric David Knut Tobias Algorithmische Bioinformatik Monday, May 25,

  41. Tobias Rausch, References September 2008 [Got82] O. Gotoh. An improved algorithm for matching biological sequences. J. Mol. Biol., 162(3): 705–708, Dec 1982. [HHR02] A. L. Halpern, D. H. Huson, and K. Reinert. Segment match refinement and applications. In WABI ’02: Proceedings of the Second International Workshop on Algorithms in Bioinformatics, pages 126–139, London, UK, 2002. Springer-Verlag. [JV92] G. Jacobson and K.-P . Vo. Heaviest increasing/common subsequence problems. In CPM ’92: Proceedings of the Third Annual Symposium on Combinatorial Pattern Matching, pages 52–66, London, UK, 1992. Springer-Verlag. [Kec93]J. D. Kececioglu. The maximum weight trace problem in multiple sequence alignment. In CPM ’93: Proceedings of the 4th Annual Symposium on Combinatorial Pattern Matching, pages 106–119, London, UK, 1993. Springer-Verlag. [NHH00]C. Notredame, D.G. Higgins, and J. Heringa. TCoffee: A novel method for fast and accurate multiple sequence alignment. Journal of Molecular Biology., 302:205–217, 2000. [NW70]S. B. Needleman and C. D. Wunsch. A general method applicable to the search for similarities in the amino acid sequence of two proteins. J. Molecular Biol., 48:443–453, 1970. [REW+08]Tobias Rausch, Anne-Katrin Emde, David Weese, Andreas Doring, Cedric Notredame, and Knut Reinert. Segment-based multiple sequence alignment. Bioinformatics, 24(16):i187–192, 2008. [SK83]D. Sankoff and J. B. Kruskal. Time Warps, String Edits, and Macromolecules: The Theory and Practice of Sequence Comparison. Addison-Wesley, Reading, MA, 1983. [SW81]T . F . Smith and M. S. Waterman. Identification of common molecular subsequences. Journal of Molecular Biology, 147(1):195–197, 1981. [WE87]M. S. Waterman and M. Eggert. A new algorithm for best subsequence alignments with application to tRNA-rRNA comparisons. Journal of Molecular Biology, 197(4):723–728, 1987. Algorithmische Bioinformatik Monday, May 25,

Recommend

Multiple Sequence Alignment using Profile HMM based on Chapter 5 and Section 6.5 from

Multiple Sequence Alignment using Profile HMM based on Chapter 5 and Section 6.5 from

0. Multiple Sequence Alignment using Profile HMM based on Chapter 5 and Section 6.5 from Biological Sequence Analysis by R. Durbin et al., 1998 Acknowledgements: M.Sc. students Beatrice Miron, Oana R at oi, Diana Popovici 1. PLAN

728 views • 36 slides
Multiple Sequence Alignment based on Ch. 6 from Biological Sequence Analysis by R. Durbin et

Multiple Sequence Alignment based on Ch. 6 from Biological Sequence Analysis by R. Durbin et

0. Multiple Sequence Alignment based on Ch. 6 from Biological Sequence Analysis by R. Durbin et al., 1998 Acknowledgements: M.Sc. student Diana Popovici M.Sc. student Oana R at oi [ MHC class I with peptide ] MHC = Major

726 views • 51 slides
CSCI 490 Bioinformatics Multiple Sequence Alignment Multiple Sequence Alignment Motivation:

CSCI 490 Bioinformatics Multiple Sequence Alignment Multiple Sequence Alignment Motivation:

CSCI 490 Bioinformatics Multiple Sequence Alignment Multiple Sequence Alignment Motivation: A faint similarity between two sequences becomes very significant if present in many sequences Definition Given N sequences x 1 , x 2

626 views • 30 slides
Efficient Parallel Implementations of Multiple Sequence Alignment Using BSP/CGM Model Jucele F.

Efficient Parallel Implementations of Multiple Sequence Alignment Using BSP/CGM Model Jucele F.

Introduction Multiple Sequence Alignment Distributed Memory Shared Memory Computational Results Conclusions and Future Work Efficient Parallel Implementations of Multiple Sequence Alignment Using BSP/CGM Model Jucele F. A. Vasconcellos,

459 views • 21 slides
Multiple sequence alignments and phylogenetic trees Multiple sequence alignment (MSA) Software

Multiple sequence alignments and phylogenetic trees Multiple sequence alignment (MSA) Software

Multiple sequence alignments and phylogenetic trees Multiple sequence alignment (MSA) Software to generate MSAs MAFFT (very good, very fast) http://mafft.cbrc.jp/alignment/software/ Clustal Omega (very good, very fast)

547 views • 25 slides
Sequence Alignment (chapter 6) The biological problem l Global alignment l Local alignment l

Sequence Alignment (chapter 6) The biological problem l Global alignment l Local alignment l

Sequence Alignment (chapter 6) The biological problem l Global alignment l Local alignment l Multiple alignment l Introduction to bioinformatics, Autumn 2006 22 Background: comparative genomics Basic question in biology: what properties

934 views • 44 slides
Algorithms in Bioinformatics: A Practical Introduction Multiple Sequence Alignment Multiple

Algorithms in Bioinformatics: A Practical Introduction Multiple Sequence Alignment Multiple

Algorithms in Bioinformatics: A Practical Introduction Multiple Sequence Alignment Multiple Sequence Alignment Given k sequences S = { S 1 , S 2 , , S k } . A multiple alignment of S is a set of k equal- length sequences { S 1 ,

652 views • 47 slides
Multiple Sequence Alignments COS551, Fall 2003 Global Multiple Sequence Alignment (MSA) Ex:

Multiple Sequence Alignments COS551, Fall 2003 Global Multiple Sequence Alignment (MSA) Ex:

Multiple Sequence Alignments COS551, Fall 2003 Global Multiple Sequence Alignment (MSA) Ex: MSA of 4 sequences MQPILLLV, MLRLL, MKILLL, and MPPVLILV : MQPILLLV MLRLL-- MK-ILLL- MPPVLILV No column is all gaps Motivation Multiple

533 views • 39 slides
Sequence Analysis 15: lecture 5 Substitution matrices Multiple sequence alignment A teacher's

Sequence Analysis 15: lecture 5 Substitution matrices Multiple sequence alignment A teacher's

Sequence Analysis 15: lecture 5 Substitution matrices Multiple sequence alignment A teacher's dilemma To understand... You first need to know... Multiple sequence alignment Substitution matrices Substitution matrices Phylogenetic trees

449 views • 41 slides
CSE 421 Algorithms Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming

CSE 421 Algorithms Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming

CSE 421 Algorithms Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming Algorithm 2 Sequence Alignment Goal: position characters in two strings to best line up identical/similar ones with one another We can do

473 views • 28 slides
CSE 427 Comp Bio Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming

CSE 427 Comp Bio Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming

CSE 427 Comp Bio Sequence Alignment 1 Sequence Alignment What Why A Dynamic Programming Algorithm 2 Sequence Alignment Goal: position characters in two strings to best line up identical/similar ones with one another We can do this

941 views • 56 slides
Sequence Alignment Sequence Alignment AGGCTATCACCTGACCTCCAGGCCGATGCCC

Sequence Alignment Sequence Alignment AGGCTATCACCTGACCTCCAGGCCGATGCCC

Sequence Alignment Sequence Alignment AGGCTATCACCTGACCTCCAGGCCGATGCCC TAGCTATCACGACCGCGGTCGATTTGCCCGAC -AGGCTATCACCTGACCTCCAGGCCGA--TGCCC--- || ||||||| |||| | || ||| ||||| TAG-CTATCAC--GACCGC--GGTCGATTTGCCCGAC Distance from sequences

767 views • 62 slides
Multiple Sequence Multiple Sequence Alignments Alignments Multiple alignment Pairwise

Multiple Sequence Multiple Sequence Alignments Alignments Multiple alignment Pairwise

Multiple Sequence Multiple Sequence Alignments Alignments Multiple alignment Pairwise alignment Infer biological relationships from string similarity Multiple alignment Infer string similarity from biological relationships

474 views • 36 slides
A Benchmark Study of Multiple Sequence Alignment Methods Ellen Nie Hang Yu CS 466 Introduction

A Benchmark Study of Multiple Sequence Alignment Methods Ellen Nie Hang Yu CS 466 Introduction

A Benchmark Study of Multiple Sequence Alignment Methods Ellen Nie Hang Yu CS 466 Introduction Multiple alignment of protein sequences has become a fundamental tool in molecular biology evolutionary studies protein

294 views • 10 slides
Sequence Alignment (chapter 6) p The biological problem p Global alignment p Local alignment p

Sequence Alignment (chapter 6) p The biological problem p Global alignment p Local alignment p

Sequence Alignment (chapter 6) p The biological problem p Global alignment p Local alignment p Multiple alignment 200 Local alignment: rationale p Otherwise dissimilar proteins may have local regions of similarity -> Proteins may share a

980 views • 56 slides
This week CSE 527 Sequence alignment Computational Biology More sequence alignment

This week CSE 527 Sequence alignment Computational Biology More sequence alignment

This week CSE 527 Sequence alignment Computational Biology More sequence alignment Autumn 2007 Weekly bio interlude - DNA replication Lectures 2-3 Sequence Alignment; DNA Replication 1 Sequence Alignment What Why

492 views • 15 slides
Alignment for Morphology Induction Tzvetan Tchoukalov Christian Monson Brian Roark Multiple

Alignment for Morphology Induction Tzvetan Tchoukalov Christian Monson Brian Roark Multiple

Multiple Sequence Alignment for Morphology Induction Tzvetan Tchoukalov Christian Monson Brian Roark Multiple Sequence Alignment in Biology prokaryote16S rRNA Columns 1623-1703 out of 7683

539 views • 29 slides
HMMs for Pairwise Sequence Alignment based on Ch. 4 from Biological Sequence Analysis by R.

HMMs for Pairwise Sequence Alignment based on Ch. 4 from Biological Sequence Analysis by R.

0. HMMs for Pairwise Sequence Alignment based on Ch. 4 from Biological Sequence Analysis by R. Durbin et al., 1998 Acknowledgement: M.Sc. student Oana R at oi [ B. subtilis PRPP synthase ] 1. PLAN 1 How to build a pair HMM for

590 views • 36 slides
CSE 427 Computational Biology Winter 2008 Sequence Alignment; DNA Replication 1 Sequence

CSE 427 Computational Biology Winter 2008 Sequence Alignment; DNA Replication 1 Sequence

CSE 427 Computational Biology Winter 2008 Sequence Alignment; DNA Replication 1 Sequence Alignment Part I Motivation, dynamic programming, global alignment 3 Sequence Alignment What Why A Simple Algorithm Complexity

892 views • 56 slides
COMPARISON OF MULTIPLE SEQUENCE ALIGNMENT METHODS PERFORMED ON 16S RIBOSOMAL RNA REFERENCE

COMPARISON OF MULTIPLE SEQUENCE ALIGNMENT METHODS PERFORMED ON 16S RIBOSOMAL RNA REFERENCE

COMPARISON OF MULTIPLE SEQUENCE ALIGNMENT METHODS PERFORMED ON 16S RIBOSOMAL RNA REFERENCE ALIGNMENTS FOR BACTERIA, ARCHAEA, AND EUKARYOTA BY DARYL DRAKE PROJECT OUTLINE Given reference alignments and their corresponding unaligned sequence

475 views • 6 slides
Challenge and novel aproaches for multiple sequence alignment and phylogenetic estimation Tandy

Challenge and novel aproaches for multiple sequence alignment and phylogenetic estimation Tandy

Challenge and novel aproaches for multiple sequence alignment and phylogenetic estimation Tandy Warnow Department of Computer Science The University of Texas at Austin Computational Phylogenetics and Metagenomics Courtesy of the Tree of Life

1.01k views • 65 slides
Pairwise Sequence Alignment based on Ch. 2 from Biological Sequence Analysis by R. Durbin et

Pairwise Sequence Alignment based on Ch. 2 from Biological Sequence Analysis by R. Durbin et

0. Pairwise Sequence Alignment based on Ch. 2 from Biological Sequence Analysis by R. Durbin et al., 1998 Acknowledgements: M.Sc. student Oana R at oi M.Sc. student Diana Popovici [ Sperm whale myoglobin (2lh7) and Lupin leghaemoglobin

1.29k views • 66 slides
Multiple Sequence Alignment Mirko Riesterer, 10.09.18 Agenda. 1 Introduction 2 Formal

Multiple Sequence Alignment Mirko Riesterer, 10.09.18 Agenda. 1 Introduction 2 Formal

Cost Partitioning Techniques for Multiple Sequence Alignment Mirko Riesterer, 10.09.18 Agenda. 1 Introduction 2 Formal Definition 3 Solving MSA 4 Combining Multiple Pattern Databases 5 Cost Partitioning 6 Experiments 7 Conclusion

884 views • 34 slides
GPU accelerated partial order multiple sequence alignment for long reads self-correction

GPU accelerated partial order multiple sequence alignment for long reads self-correction

GPU accelerated partial order multiple sequence alignment for long reads self-correction DIPARTIMENTO DI ELETTRONICA, INFORMAZIONE E BIOINGEGNERIA 19th IEEE International Workshop on High Performance Computational Biology, May 18, 2020, New

277 views • 24 slides

More recommend