press review queue primer
play

Press Review Queue Primer Judicial Committee on Information - PowerPoint PPT Presentation

Mar 11, 2023 •160 likes •373 views

Press Review Queue Primer Judicial Committee on Information Technology February 28, 2020 Meeting Paul C. Watler Jackson Walker LLP Counsel for Courthouse News Service About Courthouse News Service Nationwide news service o Reporting on

  1. Press Review Queue Primer Judicial Committee on Information Technology February 28, 2020 Meeting Paul C. Watler Jackson Walker LLP Counsel for Courthouse News Service

  2. About Courthouse News Service • Nationwide news service o Reporting on civil litigation in state and federal courts o From filing through appellate level o 2,200 subscribers • Daily new litigation reports • Five in Texas o Harris, Dallas, Tarrant, Bexar, Travis Counties o Also suburban, other Texas counties

  3. Texas Media Subscribers

  4. National Media Subscribers

  5. Other Texas Subscribers

  6. Legal News: Best When Fresh • Same‐day access to e‐filings o Supports timely reporting on newsworthy litigation • Access issues o Texas e‐filing access often delayed o Clerk processing, acceptance o Dallas, Travis counties processing approximately 25% same day of filing in 2019 o Paper‐filing era: news media traditionally had same day, behind‐the‐counter access

  7. Best When Fresh “Access should be immediate and contemporaneous . . . [t]he newsworthiness of a particular story is often fleeting. “To delay or postpone disclosure undermines the benefit of public scrutiny . . . . “[E]ach passing day may constitute a separate and cognizable infringement of the First Amendment.” ‐‐ Hon. Melinda Harmon, US District Judge CNS v. Jackson, (S.D. Tx. 2009)

  8. Best When Fresh “Access delayed is access denied. Accordingly, the Court finds that the First Amendment guarantees a qualified right of access to newly filed court documents.” ‐‐ Henry Coke Morgan Jr., US District Judge, E.D. Va. February 21. 2020

  9. E‐Filing Solution: Press Review Queue • eFileTx EFM software capable of PRQ function • Tyler provides in other jurisdictions on Odyssey platform • Provides access to e‐filings upon submission by the filer Excludes: o family law cases o sealed cases o auto‐redactions o other restricted‐access cases • Accords with case law o recognizing First Amendment right of access to newly‐filed cases

  10. Courts Providing PRQ (or like access) • United States District Courts o PACER • California o Los Angeles County Superior Court o Santa Clara County Superior Court (Tyler) o Kern County Superior Court (Tyler) o Fresno County Superior Court (Tyler) o Monterey County Superior Court (Tyler) • New York o All e‐filing trial courts (currently 52 of 62 counties) • Nevada – Clark County Court (Las Vegas) (Tyler)

  11. Courts Offering PRQ (cont.) • Georgia (Tyler) o Fulton County Court (Tyler) o Fulton State Court (Tyler) o DeKalb County Court (Tyler) o DeKalb State Court (Tyler) • Connecticut o All courts • Utah o All courts

  12. PRQ Example (Fresno County) • Screenshot of e‐filed imaged complaint o Note: not file‐stamped by clerk

  13. PRQ Example (New York State Court) • Complaint appears prior to review and acceptance by clerks o “Caution: this document has not yet been reviewed by the county clerk”

  14. PRQ Privacy Protections • PRQ Access o Available only to authorized users o password protected o subscription required for access o Subscription subject to terms of use o Terms prohibit publication of sensitive personal data

  15. PRQ Privacy Protections • CNS practices o Flag personal data to clerk o Do not post, publish • Pilot program o Subject to review after trial period

  16. PRQ Privacy Protections • Texas PRQ access Excludes: o Family law cases o Sealed cases o Other restricted‐access cases E.g., trade secrets o Cases flagged in security review o Containing sensitive personal data

  17. Texas PRQ Auto‐Excludes Sensitive Data • eFileTX log‐in

  18. Texas PRQ Auto‐Excludes Sensitive Data • Filers must choose security review o “Security” drop‐down menu o “Auto‐Redaction”

  19. Texas PRQ Auto‐Excludes Sensitive Data • “Security”—two choices: o “Contains sensitive data” o “Does not contain sensitive data.”

  20. Texas PRQ Auto‐Excludes Sensitive Data • “Auto‐Redaction” – scans for sensitive personal data E.g., social security and financial account numbers o automatically identified for redaction

  21. CNS PRQ Policy Goal • Adoption of official policy of Texas courts o Providing contemporaneous press access to e‐filings o Such as Press Queue Review Excluding: o Family law cases o Sealed cases o Other restricted‐access cases o Cases flagged in security review o Subscriber‐based o Terms of use protecting sensitive personal data

Recommend

ADT Queue 1 Queues 2 Queue of cars 3 Queue at logical level A queue is an ADT in which

ADT Queue 1 Queues 2 Queue of cars 3 Queue at logical level A queue is an ADT in which

ADT Queue 1 Queues 2 Queue of cars 3 Queue at logical level A queue is an ADT in which elements are added to the rear and removed from the front A queue is a FIFO last in, first out structure. 4 Queue at Logical Level

333 views • 12 slides
Back of queue detection Edward D. Cox, Indiana DOT 1 Back ck of queue, queue, m many option

Back of queue detection Edward D. Cox, Indiana DOT 1 Back ck of queue, queue, m many option

Back of queue detection Edward D. Cox, Indiana DOT 1 Back ck of queue, queue, m many option ons available today ay 2 Smar mart w work zone t technology 3 Probe Data choices Dashboards & Services VS. Real Time Data Feed 4 INDO

373 views • 26 slides
ECE 2574: Data Structures and Algorithms - Queue ADT C. L. Wyatt Today we will look at the Queue

ECE 2574: Data Structures and Algorithms - Queue ADT C. L. Wyatt Today we will look at the Queue

ECE 2574: Data Structures and Algorithms - Queue ADT C. L. Wyatt Today we will look at the Queue ADT: Single-ended Queue ADT Double-ended Queue (deque) ADT Array implementations Linked-list implementations Examples The Queue

751 views • 15 slides
ECE 3574: Applied Software Design Thread Safe Queue Today we are going to look in detail at how

ECE 3574: Applied Software Design Thread Safe Queue Today we are going to look in detail at how

ECE 3574: Applied Software Design Thread Safe Queue Today we are going to look in detail at how to make a data structure thread-safe. Review of std::queue push empty try_pop wait_and_pop Message Queues Exercise Review

342 views • 12 slides
Queue 7 January 2019 OSU CSE 1 Queue The Queue component family allows you to manipulate

Queue 7 January 2019 OSU CSE 1 Queue The Queue component family allows you to manipulate

Queue 7 January 2019 OSU CSE 1 Queue The Queue component family allows you to manipulate strings of entries of any (arbitrary) type in FIFO (first-in-first-out) order "First" here refers to the temporal order in which

1.3k views • 68 slides
Engaging with the Press What You Need to Know 5 Things You Should Know 1. Press room is only

Engaging with the Press What You Need to Know 5 Things You Should Know 1. Press room is only

Engaging with the Press What You Need to Know 5 Things You Should Know 1. Press room is only accessible to credentialed press. 2. Press announcements and releases should be posted to the Online Press Office. Press room is paperless. 3.

355 views • 9 slides
Priority Queue Queue Enqueue an item Dequeue: Item returned has been in the queue

Priority Queue Queue Enqueue an item Dequeue: Item returned has been in the queue

Priority Queues, Heaps, Graphs, and Sets Priority Queue Queue Enqueue an item Dequeue: Item returned has been in the queue the longest amount of time. Priority Queue Enqueue a pair <item, priority> Dequeue:

627 views • 26 slides
Stack and Queue ADT Stack Queue 2 ADT Example All main programs rely on concept of

Stack and Queue ADT Stack Queue 2 ADT Example All main programs rely on concept of

Advanced Programming Stack - Queue Summary Stack and Queue ADT Stack Queue 2 ADT Example All main programs rely on concept of Abstract It is possible to define an ADT corresponding Data Type (ADT). to a generic set of elements,

350 views • 7 slides
Queue ADT Tiziana Ligorio 1 Todays Plan Announcements Queue ADT Applications 2

Queue ADT Tiziana Ligorio 1 Todays Plan Announcements Queue ADT Applications 2

Queue ADT Tiziana Ligorio 1 Todays Plan Announcements Queue ADT Applications 2 Queue A data structure representing a waiting line Objects can be enqueued to the back of the line or dequeued from the front of the line 34

1.08k views • 94 slides
Table S2. Gene-specific PCR primer pairs for all validated SBSs. Forward primer Reverse primer

Table S2. Gene-specific PCR primer pairs for all validated SBSs. Forward primer Reverse primer

Table S2. Gene-specific PCR primer pairs for all validated SBSs. Forward primer Reverse primer Gene Name Aaed1 CGAAGCCTATAGGTGGCATT CCTAGCTTTCTGCCAAGGAG Aarsd1 GCCTCCCTTAGAGGCTTTTC CTGTGGCCCTTACCTGAATG Abcg3 CAGAGTGGGGTGACAGTTCC

91 views • 5 slides
COMP 213 Advanced Object-oriented Programming Lecture 8 The Queue ADT (cont.) Recall: The Queue

COMP 213 Advanced Object-oriented Programming Lecture 8 The Queue ADT (cont.) Recall: The Queue

COMP 213 Advanced Object-oriented Programming Lecture 8 The Queue ADT (cont.) Recall: The Queue ADT A data structure in which elements enter at one end and are removed from the opposite end is called a queue . 2 main operations:

1.18k views • 70 slides
6.006- Introduction to Algorithms Courtesy of MIT Press. Used with permission. Lecture 4 1 Menu

6.006- Introduction to Algorithms Courtesy of MIT Press. Used with permission. Lecture 4 1 Menu

6.006- Introduction to Algorithms Courtesy of MIT Press. Used with permission. Lecture 4 1 Menu Priority Queues Heaps Heapsort 2 Priority Queue A data structure implementing a set S of elements, each associated with a key,

287 views • 28 slides
Environmental Law Primer Adapted from Vermont Law Schools Environmental Law Primer for

Environmental Law Primer Adapted from Vermont Law Schools Environmental Law Primer for

Environmental Law Primer Adapted from Vermont Law Schools Environmental Law Primer for Journalists General Categories Command and Control Liability Disclosure Ecosystem and Place-based Programs Marketable Permits,

426 views • 14 slides
Priority Queues Two kinds of priority queues: Min priority queue. Max priority queue.

Priority Queues Two kinds of priority queues: Min priority queue. Max priority queue.

Priority Queues Two kinds of priority queues: Min priority queue. Max priority queue. Min Priority Queue Collection of elements. Each element has a priority or key. Supports following operations: isEmpty size

882 views • 30 slides
queue ADT Sept. 23, 2016 1 Queue dequeue (remove from enqueue front) (add at back) Queues

queue ADT Sept. 23, 2016 1 Queue dequeue (remove from enqueue front) (add at back) Queues

COMP 250 Lecture 8 queue ADT Sept. 23, 2016 1 Queue dequeue (remove from enqueue front) (add at back) Queues are heavily used in OS (operating systems) e.g. process scheduling. 2 Queue Stack enqueue( e ) push(e) dequeue() pop()

733 views • 19 slides
Queues What is a queue? First-in first-out data structure (FIFO) New objects are placed at

Queues What is a queue? First-in first-out data structure (FIFO) New objects are placed at

Queues What is a queue? First-in first-out data structure (FIFO) New objects are placed at rear Removal restricted to front Examples? Queue ADT Operations enqueue (o): Insert o at rear of queue Input: Object;

850 views • 17 slides
The Essential Advantage Harvard Business Review Press Why is it that with so many available

The Essential Advantage Harvard Business Review Press Why is it that with so many available

February 2012 Presentation for XPEG Booz & Company The Essential Advantage Harvard Business Review Press Why is it that with so many available strategy frameworks many companies still struggle with sustained value creation? Evolution of

275 views • 12 slides
PRESS ROOT TO PRESS ROOT TO CONTINUE: PRESS ROOT TO PRESS ROOT TO CONTINUE: PRESS ROOT TO

PRESS ROOT TO PRESS ROOT TO CONTINUE: PRESS ROOT TO PRESS ROOT TO CONTINUE: PRESS ROOT TO

Mario Vuksan & Tomislav PericinBlackHat USA 2013, Las Vegas PRESS ROOT TO PRESS ROOT TO CONTINUE: PRESS ROOT TO PRESS ROOT TO CONTINUE: PRESS ROOT TO PRESS ROOT TO PRESS ROOT TO PRESS ROOT TO CONTINUE: CONTINUE: CONTINUE: CONTINUE:

690 views • 45 slides
Queues The Abstract Data Type Queue FIFO queue ADT Another common linear data structure

Queues The Abstract Data Type Queue FIFO queue ADT Another common linear data structure

Queues The Abstract Data Type Queue FIFO queue ADT Another common linear data structure similar to the stack Examples using queues reading character string in order Queue is an ADT with following properties recognize

441 views • 5 slides
CSE 2123: Collections: Queues and Stacks Jeremy Morris 1 Collections - Queue A queue is a

CSE 2123: Collections: Queues and Stacks Jeremy Morris 1 Collections - Queue A queue is a

CSE 2123: Collections: Queues and Stacks Jeremy Morris 1 Collections - Queue A queue is a specific type of collection Imagine a line for a bank teller or a checkout lane at a store Contains many people But only the one at the

307 views • 26 slides
Data Structures in Java Lecture 7: Queues. 9/30/2015 Daniel Bauer 1 The Queue ADT A Queue

Data Structures in Java Lecture 7: Queues. 9/30/2015 Daniel Bauer 1 The Queue ADT A Queue

Data Structures in Java Lecture 7: Queues. 9/30/2015 Daniel Bauer 1 The Queue ADT A Queue Q is a sequence of N objects A 0 , A 1, A 2, , A N-1 A 0 is called the front of Q, A N-1 is called the back of Q. A queue has two

580 views • 30 slides
Priority Queues, Heaps, Graphs, and Sets Priority Queue Queue Enqueue an item

Priority Queues, Heaps, Graphs, and Sets Priority Queue Queue Enqueue an item

Priority Queues, Heaps, Graphs, and Sets Priority Queue Queue Enqueue an item Dequeue: Item returned has been in the queue the longest amount of time. Priority Queue Enqueue a pair <item, priority> Dequeue:

786 views • 52 slides
Queue Mode Scheduling at Subaru Telescope Eric Jeschke Software Division eric@naoj.org Queue

Queue Mode Scheduling at Subaru Telescope Eric Jeschke Software Division eric@naoj.org Queue

Queue Mode Scheduling at Subaru Telescope Eric Jeschke Software Division eric@naoj.org Queue Scheduling Subaru's plan is to use automated queue scheduling, guided by human oversight To schedule a night in queue mode, we schedule

606 views • 14 slides
What is a queue? First-in first-out data structure (FIFO) Queues New objects are

What is a queue? First-in first-out data structure (FIFO) Queues New objects are

What is a queue? First-in first-out data structure (FIFO) Queues New objects are placed at rear Removal restricted to front Examples? Queue ADT Operations Example enqueue (o): Insert o at rear of queue enqueue(5)

170 views • 3 slides

More recommend