Insights from the first RT-qPCR based human transcriptome profiling - PowerPoint PPT Presentation

Slide 1 of 38 Insights from the first RT-qPCR based human transcriptome profiling based on wet lab validated assays Jan Hellemans, PhD CEO Biogazelle qPCR & NGS 2013 – Freising, Germany March 19, 2013

Biogazelle Slide 2 of 38 Slide 2 of 38

The biogazelle team and collaborators Slide 3 of 38 Slide 3 of 38 Biogazelle Barbara D’haene � Pieter Mestdagh � Gaëlle Van Severen � Nele Nijs � Anthony Van Driessche � Manuel Luypaert � Shana Robbrecht � Ariane Deganck � Jo Vandesompele � Ghent University Steve Lefever � VIB nucleomics core Bio-Rad

Introduction Slide 4 of 38 Slide 4 of 38 qPCR: reference technology for nucleic acid quantification � sensitivity and specificity � wide dynamic range � speed � relative low cost � conceptual and practical simplicity easy to perform ≠ easy to do it right � many steps involved � all need to be right

Prepare – cycle – report Slide 5 of 38 Slide 5 of 38 relative experiment design quantification C P R quality control samples prepare cycle report statistical analysis assays

Prepare – cycle – report Slide 6 of 38 Slide 6 of 38 relative experiment design quantification C P R quality control samples prepare cycle report statistical analysis assays

Assays & MIQE Slide 7 of 38 Slide 7 of 38 design � amplicon length � primer positions (exonic or intron-spanning) � transcript coverage in-silico � specificity prediction (retropseudogenes and other homologues) � secondary structure analysis wet lab � specificity assessment (gel, melt, sequence) � Cq of NTC (for SYBR assays) � amplification efficiency determination (slope, E, SE(E), r ² )

Dealing with MIQE Slide 8 of 38 Slide 8 of 38 DIY experts in qPCR � spend a lot of effort in doing it right DIY novel to qPCR � adhering to the MIQE guidelines is a challenge users of commercial assays � if they sell it, it must be good

Dealing with MIQE Slide 9 of 38 Slide 9 of 38 DIY experts in qPCR � spend a lot of effort in doing it right à save time DIY novel to qPCR � adhering to the MIQE guidelines is a challenge à focus on biological question rather than technical qPCR challenges users of commercial assays � if they sell it, it must be good à have proof that it is good

The perfect assay Slide 10 of 38 Slide 10 of 38 Properties of the perfect assay � specific for the gene of interest (no off-target amplification) � detection of all transcript variants � detection not affected by polymorphisms (no allelic bias or drop out) � amplification efficiency ~100% � no gDNA co-amplification � no primer dimer formation

The perfect assay Slide 11 of 38 Slide 11 of 38 Some genes cannot have a perfect assay � no unique sequences (homology with other genes – pseudogenes) � not a single part of the gene occurs in all transcripts � regions are excluded because of repeats, secondary structures, SNPs, homology, ... Make the best possible compromise and report any potential issues Design à in-silico quality control à lab validation

Assay designs Slide 12 of 38 Slide 12 of 38 primerXL (UGent) � database of genomic information � tools for target region selection

Gene sequence fragmentation for target region selection Slide 13 of 38 Slide 13 of 38 1 gene, 3 transcripts, 6 fragments (coverage frequency 1 to 3) gene ¡ transcript ¡1 ¡ transcript ¡2 ¡ transcript ¡3 ¡ 2 ¡ 3 ¡ 2 ¡ 3 ¡ 2 ¡ 1 ¡

Assay designs Slide 14 of 38 Slide 14 of 38 primerXL (UGent) � database of genomic information � tools for target region selection � primer3 based primer design � analysis of secondary structures and SNPs in primer binding regions � specificity prediction (BiSearch) � relaxation cascade

BiSearch specificity prediction Slide 15 of 38 BiSearch loose BiSearch strict � 1222222222222222 � 1233333333333 � only the gene of interest

BiSearch specificity prediction Slide 16 of 38 BiSearch loose BiSearch strict � 1222222222222222 � 1233333333333 � only the gene of interest (FFAR2) reads ¡ seq ¡ gene_list ¡ official_symbol ¡ loca8on ¡ 2843 ¡ CATGGCAGTCACCATCTTCTGCTACTGGCGTTTTGTGTGGATCATGCTCTCCCAGCCCCTTGTGGGGGCCCAGAGG ENSG00000126262 ¡ FFAR2 ¡ 19:35940617-­‑35942667 ¡ CGGCGCCGAGCCGTGGGGCTGGCTGTGGTGACGCTGCTCAATTTCCTGGTGTGCTTCGGACCTTACAGATCGGAA 1897 ¡ GTAAGGTCCGAAGCACACCAGGAAATTGAGCAGCGTCACCACAGCCAGCCCCACGGCTCGGCGCCGCCTCTGGGCC ENSG00000126262 ¡ FFAR2 ¡ 19:35940617-­‑35942667 ¡ CCCACAAGGGGCTGGGAGAGCATGATCCACACAAAACGCCAGTAGCAGAAGATGGTGACTGCCATGAGATCGGAA 1535 ¡ GTAAGGTCCGAAGCACACCGAGAGCTGGGAGCAGGAGCTACACAGTCTGCTGGCCTCACTGCACACCCTGCTGGGG ENSG00000141456 ¡ AC091153.1 ¡ 17:4574680-­‑4607632 ¡ GCCCTGTACGAGGGAGCAGAGACTGCTCCTGTGCAGAATGAAGGCCCTGGGGTGGAGATGCTGCTGTCCTCAGAA 1097 ¡ CATGGCAGTCACCATCTTCTGAGGACAGCAGCATCTCCACCCCAGGGCCTTCATTCTGCACAGGAGCAGTCTCTGC ENSG00000141456 ¡ AC091153.1 ¡ 17:4574680-­‑4607632 ¡ TCCCTCGTACAGGGCCCCCAGCAGGGTGTGCAGTGAGGCCAGCAGACTGTGTAGCTCCTGCTCCCAGCTCTCGG 1091 ¡ CATGGCAGTCACCATCTTCTGAGGACAGCAGCATCTCCACCCCAGGGCCTTCATTCTGCACAGGAGCAGTCTCTGC ENSG00000141456 ¡ AC091153.1 ¡ 17:4574680-­‑4607632 ¡ TCCCTCGTACAGGGCCCCCAGCAGGGTGTGCAGTGAGGCCAGCAGACTGTGTAGCTCCTGCTCCCAGCTCTCGGT

Gene homology prevents perfect designs Slide 17 of 38 Slide 17 of 38 distances (clustalW) between all genes without perfect design 50% 45% 40% 35% 30% 25% 20% 15% 10% 5% 0% 1 32 63 94 125 156 187 218 249 280 311 342 373 404 435 466 497 528 559 590 621 652 683 714 745 776 807 838 869 900 931 962 993 1024 1055 1086 1117 1148 1179 1210 1241 1272 1303 1334 1365 1396 1427 1458 1489 1520 1551 1582 1613 1644 1675 1706 1737 1768 1799 1830 1861 1892 1923 1954 1985 2016 1532 / 2043 (75%) of genes without perfect design have homologous genes that differ less than 12.5% (2 variations per 16 bases)

Wet lab validation Slide 18 of 38 Slide 18 of 38 PCR composition � total volume: 5 ul � instrument: CFX-384 (with automation) mastermix: SsoAdvanced SYBR � � primer conc: 250 nM each PCR program � default cycling protocol for SsoAdvanced SYBR (Ta=60°C) Samples cDNA: 25 ng (total RNA equivalents – Agilent Universal human reference RNA) � gDNA: 2.5 ng (Roche) � � NTC: water + carrier (5 ng/µl yeast transfer RNA) � synthetic template (pooled 60-mers in concentration range: 2E7 – 2E1 copies)

Some numbers Slide 19 of 38 Slide 19 of 38 lab validation of 50 133 assays (human and mouse) 829 056 reactions 2 159 PCR plates (384-well) 172m equivalent to 8 636 PCR plates (96 well)

Two generations of external oligonucleotide standards Slide 20 of 38 Slide 20 of 38 Vermeulen et al., Nucleic Acids Research, 2009 � 55-mer � standard desalted � 3’ blocked to prevent elgongation � 5 points dilution series: 150 000 molecules > 15 molecules FP stuffer RCRP New approach: easier + cheaper + as good � 60-mer � first (5’) and last (3’) 30 nucleotides of amplicon sequence � standard desalted � no 3’ blocking � 7 points dilution series: 20 000 000 > 20 molecules 30 nt 5’ 30 nt 3’

Synthetic templates are equivalent to natural templates Slide 21 of 38 Slide 21 of 38 comparison between short ss synthetic template and full length ds template � > 300 assays 20000000 2000000 ds template ss oligo r ² <0.99 1 1 200000 median E 2.00 2.01 average E 2.00 2.01 20000 count E <> [1.90-2.10] 1 3 2000 paired t-test p-value 0.14 200 20 10 15 20 25 30 35

Efficiency evaluation Slide 22 of 38 Slide 22 of 38 amplification efficiency � 6 orders of magnitude � 20 – 20M copies � linear over entire range � LOD (LOQ) ≤ 20 molecules � E in 90-110% range

Efficiency distribution (n = 50 133) Slide 23 of 38 Slide 23 of 38 89%

Efficiency distribution (n = 50 133) Slide 24 of 38 Slide 24 of 38 redesign 89% redesign

NGS as preferred method for specificity assessment Slide 25 of 38 Slide 25 of 38 amplicon sizing ( + melt analysis for SYBR assays) � limited sensitivity for detecting low level non-specific coamplification � failure to observe non-specific amplification of sequences with similar size and/or Tm e.g. expressed pseudogenes or homologous genes Next level of specificity assessment � in-silico specificity predictions by BiSearch � massively parallel sequencing of pooled PCR products � average coverage > 1000-fold à lab specificity > 99.9% � 50 – 200 times more sensitive than size analysis and Sanger sequencing

Most assays are 100% on-target Slide 26 of 38 Slide 26 of 38

2/3 of non-specific assays may go unnoticed without NGS Slide 27 of 38 Slide 27 of 38 assays with off-target reads 100% 0.9 < x < 1 0.8 < x < 0.9 0.7 < x < 0.8 75% % on-target 0.6 < x < 0.7 0.5 < x < 0.6 50% 0.4 < x < 0.5 0.3 < x < 0.4 0.2 < x < 0.3 25% 0.1 < x < 0.2 0 < x < 0.1 0% 0% 10% 20% 30% 40% 50% 60%

MIQE compliant PrimePCR assay validation data sheet Slide 28 of 38 Slide 28 of 38