Influence of Temperature on MBBR Denitrification for Advanced - PowerPoint PPT Presentation

Influence of Temperature on MBBR Denitrification for Advanced Nitrogen Removal of Wastewater Treatment Plant Effluent Haiyan Wang K. Liu,Q.Y. Hang, Q. Yuan, M.J. Ma, and C. M. Li Research Center for Water Pollution Control Technology Chinese Research Academy of Enviromental Sciences Tel:86-10-84915322, Email: 2016.09.16 wanghy@craes.org.cn

Outline 1 Background Background 2 Objective Objective 3 Materials and Methods Materials and Methods 4 Results and Disscussion Results and Disscussion 5 Conclusions Conclusions

1 BACKGROUND

Advanced nitrogen removal is necessary for the WWTP effluent reuse • Water shortage has becoming a serious problem • Water shortage has becoming a serious problem 1 • The amount of municipal wastewater treatment • The amount of municipal wastewater treatment plant (WWTP) effluent was large(3.4 × 10 10 plant (WWTP) effluent was large(3.4 × 10 10 ton/year) ton/year) • WWTP effluent is a good resource as reclaimed • WWTP effluent is a good resource as reclaimed 2 water. water. 80.8 ± 8.4% NO 3 - -N •TN 15mg/L ？ •TN 15mg/L ？ 1.5mg/L 1.5mg/L 3 IV recharge water for water sources, natural wetlands or rivers Discharge Standard of Pollutants Environmental Quality for Municipal Wastewater Standards for Surface Water Treatment Plant (GB18918-2002) (GB3838-2002)

Moving Bed Biofilm Reactor Influent Effluent Actived Sludge MBBR Aeration/ Mixing Bioflim Denitrification MBBR reported for sewage wastewater (Aspegren et al., 1998; Mases et al. 2010), nitrate contaminated seawater(Labelle, et al., 2005) and landfill leachate (Cortez et al., 2011) nitrogen removal with good denitrification effficiency.

Denitrifiction MBBR could be used for WWTP effluent reuse The full ‐ scale MBBRs had also been applied since 1997 & 1999 for post denitrification in Sjölunda and Klagshamn WWTPs of Malmö City, Sweden, and the effluent TN could met the WWTP limitation (Mases et al. 2010). Carriers types hydraulic retention time (HRT) Influencing factors temperature the ratio of carbon to total nitrogen(C/N) mixing speed

2 OBJECTIVE

Objective • The denitrification MBBR has been developed for WWTP effluent advanced nitrogen removal, and the influencing of carriers types, hydraulic retention time (HRT) and C/N ratio on its efficiency have been studied extensively in our published studies (Yuan et al. 2015; 2016). denitrification efficiency influence HOW the Temperature Microorganisms denitrificans community Variation obviously change? in different seasons in North China WWTPs built outside

Denitrification functional Genes Nir Nor Nos Nar nirS norB nosZ narG - - NO 2 NO NO 3 N 2 O N 2 nirK norZ napA Cu ‐ Nir Nap qNor qPCR molecular approach

3 MATERAIALS AND METHODS

Equipments and carriers Polyethylene carriers with 25 mm diameter, 10 mm height, 0.96~0.98 g/L density and 620 m 2 /m 3 specific surface area. MBBR : 6.0 L volume and 5.7 L effective volume Influent : Secondary sedimentation tank effluent of Beijing Yongfeng WWTP C/N ratio: methanol addition to adjust C/N ratio to 8 HRT 12h Table1 Influent ingredients and operation conditions Time(d) Temperature( � ) CODCr(mg/L) TN(mg/L) NO 3 ‐ ‐ N (mg/L) 104.6 ± 86.3 11.1 ± 7.0 4.8 ± 2.6 Phase I(1 ‐ 49d) 13 109.7 ± 82.0 12.0 ± 7.6 4.2 ± 2.6 PhaseII(50 ‐ 98d) 19 PE 87.8 ± 29.7 10.7 ± 2.7 3.9 ± 2.1 PhaseIII(99 ‐ 147d) 25 85.6 ± 30.4 10.6 ± 2.7 4.0 ± 2.1 PhaseIV(148 ‐ 190d) 30

Sequencing batch test in one HRT MBBR : 2.5 L volume and 2.0 L effective volume Influent : Secondary sedimentation tank effluent of Beijing Yongfeng WWTP Carriers filling rate: 30% C/N ratio: methanol addition to adjust C/N ratio to 8 HRT: 12h Sampling once every hour for 8 times in one HRT Temperature( ‐ ‐ N (mg/L) Time(d) CODCr(mg/L) TN(mg/L) NO 3 � ) 1 ‐ 3 30 117.8 11.1 4.6 4 ‐ 6 25 109.0 11.9 4.1 7 ‐ 9 20 91.4 11.8 4.5 10 ‐ 12 15 113.4 11.2 4.3 13 ‐ 15 10 95.8 11.6 4.4

Analytical methods Water Quality Index Detection TN :TN unit of TOC ‐ V CPH analyzer ‐ ‐ N and NO 2 ‐ ‐ : Ion chromatography (Dionex ICS ‐ 1000 NO 3 + ‐ N :Nessler's reagent spectrophotometry method NH 4 COD :COD speedy testing pH :S ‐ 25 pH Analyzer DOM analysis Three ‐ dimensional excitation ‐ emission matrix (EEM) fluorescence spectrophotometer Excitation source was used for the spectrometer, both excitation (Ex) and emission (Em) were 200 ‐ 450 nm with 5 nm bandwidth, and the scanning speed was 12000 nm•min ‐ 1 .

Analytical methods DNA extraction and qPCR analysis DNA extraction: UltraClean DNA extraction kit Two ‐ step Q ‐ PCR amplification procedure: 95 � for 10 min; 40 cycles of 95 � for 15 s, 60 � for 1 min. Primers References NarG ‐ F 5’ ‐ TA(CT)GT(GC)GGGCAGGA(AG)AAA ‐ 3’ Smith et al., 2015 NarG ‐ R 5’ ‐ CGTAGAAGAAGCTGGTGCTGTT ‐ 3’ NirS ‐ F 5’ ‐ GTSAACGTSAAGGARACSGG ‐ 3’ Kandeler et al., 2006 NirS ‐ R 5’ ‐ GASTTCGGRTGSGTCTTGA ‐ 3’ NosZ ‐ F 5’ ‐ CG(C/T)TGTTC(A/C)TCGACAGCCAG ‐ 3’ Mao et al., 2011 NosZ ‐ R 5’ ‐ G(G/C)ACCTT(G/C)TTGCC(C/G)T(T/C)GCG ‐ 3 Biomass analysis and SEM observation Biomass: SS weight method (Liu, 1992) SEM:HITACHI S ‐ 570 SEM

4 RESULTS AND DISCUSSION

Influence of temperature on Nitrogen Removal ‐ ‐ N Removal Influence of temperature on NO 3 20 25(฀ ) 13(฀ ) 19(฀ ) 30(฀ ) 100 ‐ ‐ N removal NO 3 3 -N removal rate (%) 16 — N removal Temper NO 3 ‐ ‐ rate ( mg NO 3 80 ‐ ‐ N (mg/L) ature( � ) NO 3 (%) 3 -N(mg/L) N ∙ (L ∙ d) ‐ 1 ) 12 60 4.8 ± 2.6 82.9 ± 26.7 %, 4.8 ± 2.6 13 8 40 4.2 ± 2.6 80.1 ± 27.2 % 4.2 ± 2.6 19 - NO 20 4 - NO 3.9 ± 2.1 85.0 ± 22.3 % 3.9 ± 2.1 25 0 0 4.0 ± 2.1 82.9 ± 13.3% 4.0 ± 2.1 30 0 50 100 150 200 Time d （ ） Influent Effluent Removal rate The NO 3 - -N · removal and denitrification rate changed little with the temperature variation, and it indicated the temperature has little effect on the nitrate removal at 12h HRT, which might be because the long HRT (12h) of the MBBR could compensate for the low denitrification rate at low temperature.

Influence of temperature on Nitrogen Removal ‐ ‐ N Removal Influence of temperature on NO 3 in sequencing batch tests 5 10(฀ ) Time for 15(฀ ) Tempe The complete 20(฀ ) 4 rature( denitrification — N NO 3 25(฀ ) � ) Rate(mg/L ∙ h) 30(฀ ) removal (h) 3 -N/(mg/L) 3 10 7 0.64 2 15 7 0.58 - NO 6 20 1.12 1 25 5 1.29 0 30 5 1.14 -1 0 1 2 3 4 5 6 7 8 9 Time(h) With the long HRT(12h), the microorganisms at low temperature could arrive the same removal efficiency as that of the high temperature for the time compensation (Zinatizadeh & Ghaytooli, 2015). The batch tests also explained why the similar nitrate removal were obtained at long HRT (12h ) at 13 � , 19 � , 25 � and 30 � .

Influence of temperature on Nitrogen Removal Influence of temperature on the Removal of Nitrogen in Other Form Temper TN + ‐ N ‐ ‐ N NH 4 NO 2 atu ‐ re ( � ) Influent Effluent Influent Effluent Influent Effluent Removal Removal (mg/L) Removal (mg/L) (mg/L) (mg/L) (mg/L) (mg/L) 27.2 ± 46. 4.3 ± 3.6 11.1 ± 6.9 5.5 ± 4. 53.1 ± 2 0.8 ± 0.7 0.5 ± 0.4 2.0 ± 1.2 1.8 ± 0.8 13 3 1 8.4 23.5 ± 51. 4.1 ± 3.3 12.0 ± 6.9 6.2 ± 4. 49.0 ± 2 0.9 ± 0.8 0.7 ± 0.4 2.0 ± 1.2 1.9 ± 0.7 19 1 2 8.2 30.5 ± 24. 4.2 ± 7.1 10.7 ± 2.7 4.9 ± 2. 52.8 ± 1 0.8 ± 0.3 0.6 ± 0.4 2.3 ± 0.7 2.3 ± 0.6 25 9 2 6.8 31.3 ± 11. 6.1 ± 7.3 10.5 ± 2.8 4.8 ± 3. 54.6 ± 2 0.7 ± 0.4 0.5 ± 0.3 2.5 ± 0.6 2.4 ± 0.7 30 1 0 3.9 The low NH 4 + -N and NO 2 - -N varied little with the temperature , and they were not influenced obviously by the temperature in the batch tests. TN were also not affected by temperature obviously.

Influence of temperature on Organic Removal COD removal  The COD Cr removal were 53.3 ± 44.9%, 52.5 ± 30.6%, 65.5 ± 18.6% and 63.8 ± 19.5%, which indicated that the temperature had little effect on the COD removal  In batch tests, the CODcr removal were steady after 5h operation, and the COD Cr removal rate increased gradually with the temperatures of 10 � , 15 � , 20 � , 25 � and 30 � .

Influence of temperature on Organic Removal DOM removal Inffluent Effluent Peak I and II: tryptophan-like substances Peak III: the visible fulvic acid-like substance Peak IV: the UV fulvic acid-like substance Effluent Effluent Effluent The total fluorescence intensity removal were 47.6%, 49.0%, 50.5% and 52.5% respectively

Microbiology characteristics at different temperature Biomass analysis and SEM observation Temperature( 13 19 25 30 � ) Bioma (mg/g) 6.9 9.4 11 14.1 ss 13 30 25 Bacilliform, filiform and spheroidal form Temperature had little influence on the carriers surface morphology, which 19 consisted with the biomass analysis.