HIV-1 Tropism Arevir workshop Martin Obermeier Specialist for - PowerPoint PPT Presentation

HIV-1 Tropism – Arevir workshop Martin Obermeier Specialist for laboratory medicine Associate Medical center for infectious diseases Berlin – Germany M. Obermeier 5/2013

Targets for HIV drug therapy plasma RNA proviral DNA Adapted from http://www.nature.com/embor/journal/v4/n6s/fig_tab/embor857_f2.html M. Obermeier 5/2013

6558 TGGGATCAAAGCCTAAAGCCATGTG GGGTTCTTRGGAGCAGCAGGAAGCACT 7785 V3 TAATTGTGGAGGGGAATTTT 7371 6957 GTACAATGTACACATGGAAT Genotypic approach for coreceptor-detection http://www.hiv.lanl.gov/content/hiv-db/MAP/landmark.html M. Obermeier 5/2013

Geno2pheno[coreceptor] Probability with which a CCR5-tropic virus Specificity = 1 - FPR is falsely classified as CXCR4-tropic www.geno2pheno.org M. Obermeier 5/2013

Patient 60301  50 yo male  HIV diagnosis 07/1995  Treatment history  7/95 - 1/96: AZT + 3TC  1/96 - 7/96: AZT + 3TC + SQV-hgc  7/96 - 9/96: AZT + 3TC + IDV  9/96 - 8/97: d4T + ddI + IDV  8/97 - 10/97: d4T + ddC + IDV  10/97 - 2/98: d4T + ddC + SQV-sgc + RTV  2/98 - 1/00: d4T + ddC + SQV-sgc + RTV + NVP  1/00 - 7/00: CBV + ABC + APV  7/00 – 9/03: TZV + APV + RTV  9/03 – 12/05: d4T + TDF + LPV/RTV  12/05 – 10/07: ABC/3TC/AZT + TDF + TPV +RTV M. Obermeier 5/2013

Patient 60301 M. Obermeier 5/2013

Patient 60301 M. Obermeier 5/2013

Patient 60301 Protease: L10V, K20V, L33V, M36I, M46I, G48V, I54S, A71I, V82AT, I84V M. Obermeier 5/2013

Patient 60301 3TC + DRV/ r 3TC + DRV/ r + MVC Genotype: CCR5 phenotype: D/M M. Obermeier 5/2013

Patient 60301 3TC + DRV/ r 3TC + DRV/ r + MVC genotype: CCR5 phenotype: D/ M M. Obermeier 5/2013

“True” distribution R5 X4 M. Obermeier 5/2013

Distribution predicted with method A X4-prediction method A R5 X4 M. Obermeier 5/2013

Distribution predicted with method B R5 X4 X4-prediction method B M. Obermeier 5/2013

M. Obermeier 5/2013

Patient 153  38 years old, male  HIV diagnosis 1986, Risk MSM  Begin of first ART: 1998  ART-experience: 3TC, ABC, d4T, TDF, FTC, NVP, EFV, SQV, Lopinavir, Ritonavir (fulldose and booster), Darunavir  Last cART: TDF/FTC + NVP M. Obermeier 5/2013

Patient 153 M. Obermeier 5/2013

Patient 153  No tropism testing from viral RNA possible  Tropism testing from proviral DNA: CCR5-tropic (FPR 31%)  Genotypic Resistance: No drug resistance associated mutations  Switch to MVC + RAL M. Obermeier 5/2013

Patient 153 M. Obermeier 5/2013

Patient 153  Integrase-gene: N155H  CXCR4-Tropism detected from viral RNA (FPR: 0.1%)  But:  In overall cohort 6 Patients with dual MVC + RAL treatment Maraviroc and Raltegravir  4 Patients show a viral load <50 cop/ml ant week 48 M. Obermeier 5/2013

ROC’n RAL  Maraviroc plus Raltegravir dual Therapy in Aviremic HIV infected Patients with Lipodystrophy : Results from the ROCnRAL ANRS 157 Study. Katlama et al. CROI 2013 #566 M. Obermeier 5/2013

Main inclusion criteria  type B or CRF02 HIV-1.  ≥ 18 years old  ART for at least 5 years, and stable ART for at least 6 months.  HIV-RNA < 200 copies/mL over the last 24 months, and < 50 copies/mL for at least 12 months. •R5 tropic virus on HIV- DNA and with CD4 nadir ≥ 100/mm3 OR R5 tropic virus on HIV-DNA (FPR >20%) and HIV-RNA of the last detectable viral load, irrespective of CD4 load.  Clinical lipohypertrophy and defined by increased volume of the abdominal and/or thoracic and/or cervical area (buffalo hump).  Naïve for raltegravir and maraviroc. M. Obermeier 5/2013

Study Flow chart M. Obermeier 5/2013

Discontinuation of study due to recommendation of DMSB M. Obermeier 5/2013

M. Obermeier 5/2013

What do you think? M. Obermeier 5/2013

What I think:  We need to collect more data http://www.eucohiv.org/ M. Obermeier 5/2013