geno2pheno[ngs-freq]: a novel tool for drug resistance testing in - PowerPoint PPT Presentation

geno2pheno[ngs-freq]: a novel tool for drug resistance testing in the era of next- generation sequencing Matthias Döring Max Planck Institute for Informatics AREVIR Meeting 2018 - New Strategies - May 9, 2018

Imagine the following patient Source: myhaliburtonnow.com/20094/wilberforce-clinic-opens-tomorrow/ Diagnosis & Treatment HIV-1 positive person Source: med.upenn.edu Sanger sequencing Genotypic drug resistance testing May 9, 2018 2

Resistance test comes back negative Selected treatment TDF + FTC + DRV Interpretation through HIV-GRADE May 9, 2018 3

Virological failure is identified during routine monitoring in month 6 after treatment initiation Failure! FTC + TDF + DRV Monitoring 100000 660 640 10000 620 Viral load 600 1000 580 100 560 540 10 520 1 500 BL Month 3 Month 6 Time Viral load CD4 Maybe we should investigate the resistance status again? May 9, 2018 4

M184I found in the second resistance test NRTI resistance interpretation of HIV-GRADE Drug GRADE HIVdb geno2pheno FTC R R R TDF S S R DRV S S S Resistance to selected regimen Treatment has to be adjusted! Could this have been avoided? May 9, 2018 5

Yes it could have – if we had used next- generation sequencing PASeq PASeq.org HyDRA hydra.canada.ca Source: med.upenn.edu Source: support.illumina.com Next-generation sequencing (NGS) Sanger sequencing Genotypic drug resistance testing for NGS data Genotypic drug resistance testing May 9, 2018 6

Results from geno2pheno[ngs-freq] for the corresponding NGS sample Drug >= 10% >= 2% FTC S R TDF S R DRV S S May 9, 2018 7

Existing web servers for NGS data Reference sequence GATAAATCTGGTCTTATTTCC CTAGGATAAATCTGGTCTTATTTCCTTAG GATAATTCTGGTCTTATTTCC GATAAATCTGGTCTTATTTCC ----GATAAATCTGGTCTTATTTCC---- GATAAATCTGCTCTTATTCCC ----GATAATTCTGGTCTTATTTCC---- GATAAATCTGGTCTTATTTCC ----GATAAATCTGCTCTTATTCCC---- GATAAATCTGGTCTTATTTCC CTAGGATAAATCTGGTCTTATTTCC---- CATAATTCTGGTCTTATTTCC -TAGGATAAATCTGGTCTTATTTCCT--- GATAAATCTGGTCTTATTTCC PASeq --AGGATAAATCTGGTCTTATTTCCTT— CATAATTCTGGTCTTATTTCC --AGGATAAATCTGGTCTTATTTCCTTA- PASeq.org Input: raw sequencing data --AGGATAAATCTGGTCTTATTTCCTTAG Read processing pipeline: filtering, mapping, variant calling Limitations - Time-intensive - Rules-based interpretation only - Support for HIV-1 only - Predetermined HyDRA processing pipeline Rules-based resistance interpretation hydra.canada.ca Noguera-Julian M, Edgil D, Harrigan PR, Sandstrom P, Godfrey C, Paredes R. Next-Generation Human Immunodeficiency Virus Sequencing for Patient Management and Drug Resistance Surveillance. J. Infect. Dis. 2017;17:19752. May 9, 2018 8

geno2pheno[ngs-freq] relies on frequency files Excerpt from a single-nucleotide frequency file May 9, 2018 9

How does geno2pheno[ngs-freq] work? May 9, 2018 10

Limitations Frequency files Minority resistant variants - Co-occurrence cannot be studied - Impact needs more thorough study [1,2] - NGS data need to preprocessed - Proviral contamination possible (APOBEC) - Worst-case prediction may be too sensitive 1. Cozzi-Lepri,A. et al. (2015). J. Antimicrob. Chemother . https://doi.org/10.1093/jac/dku426 2. Johnson,J.A. and Geretti,A.M. (2010). J. Antimicrob. Chemother. https://doi.org/10.1093/jac/dkq139 May 9, 2018 11

Why should you use geno2pheno[ngs-freq]? Only NGS service for HCV Access to statistical model Established methods Source: thenounproject.com Integrable into existing Minority detection Rapid results pipelines May 9, 2018 12

Where can I find geno2pheno[ngs-freq]? http://ngs.geno2pheno.org Döring,M. et al. (2018) geno2pheno[ngs-freq]: a genotypic interpretation system for identifying viral drug resistance using next-generation sequencing data . Nucleic Acids Res. , 10.1093/nar/gky349. www.geno2pheno.org https://doi.org/10.1093/nar/gky349 May 9, 2018 13

Interested in real-life applications? Source: http://blog.strategyzer.com/posts/2014/12/02/how-to-design-great-workshops Join our NGS workshop later today! 15:45 – 16:45 and 16:45 – 17:45 May 9, 2018 14

Thanks for your attention and thanks to … Georg Friedrich Thomas Lengauer Nico Pfeifer Alejandro Pironti Prabhav Kalaghatgi Achim Büch Max Planck Institute for Broad Institute, Methods in Medical Max Planck Institute Max Planck Institute Max Planck Institute for Informatics, Informatics, Cambridge, MA, for Informatics, for Informatics, Informatics, Saarbrücken University of Tübingen USA Saarbrücken Saarbrücken Saarbrücken Martin Obermeier Alexander Thielen Martin Däumer Rolf Kaiser Elena Knops Eva Heger Medizinisches SeqIT, Kaiserslautern Institute for Virology, Institute for Virology, Infektionslogiezentrum Institute for Virology, SeqIT, Kaiserslautern University of Cologne Berlin (MIB), Berlin University of Cologne University of Cologne May 9, 2018 15