evolving prolog
play

Evolving Prolog gene expression programming mndrix The Problem - PowerPoint PPT Presentation

Evolving Prolog gene expression programming mndrix The Problem Lending Club peer to peer loans which ones are good? data! The Result 98% success p2pquant.com note selection Genetic Algorithms because giraffes Candida Ferreira FTW!


  1. Evolving Prolog gene expression programming

  2. mndrix

  3. The Problem

  4. Lending Club peer to peer loans

  5. which ones are good?

  6. data!

  7. The Result

  8. 98% success

  9. p2pquant.com note selection

  10. Genetic Algorithms

  11. because giraffes

  12. Candida Ferreira FTW!

  13. Genotype

  14. ATGCTTCGGCAAGACTCAAAAAATA

  15. Phenotype

  16. Ophrys apifera

  17. xkcd 1259

  18. Genotype : Phenotype Source : AST

  19. *b+a-aQa b+//+b+babbabbbababbaaa

  20. and credit FICO > inquiries < 700 2 Investment strategy

  21. Prolog

  22. Why Prolog?

  23. ?- writeln(hi). hi ?- X=writeln(hi). X = writeln(hi). ?- call($X). hi homoiconic

  24. ?- X=writeln(Message). X = writeln(Message). ?- X=writeln(Message), Message=hi. Message = hi, X = writeln(hi). ?- call($X). hi logic variables

  25. *b+a-aQa b+//+b+babbabbbababbaaa

  26. declarative

  27. Fitness Function internal rate of return

  28. Generations you kids get off my lawn

  29. 98% satisfied

  30. p2pquant.com thanks

Recommend


More recommend