Considerations for the Hybrid Use of Trade Secret and Patent Protection of Green Technology 26 th Annual Intellectual Property Law Conference American Bar Association Section of Intellectual Property Law Susan Perng Pan span@sughrue.com April 6-9, 2011
Considerations for a “Hybrid” IP Approach to Green Technology Costs � Requirements for trade secret � Information is of economic or competitive value � Formulas, drawings, patterns, compilations, programs, � devices, methods, techniques, processes Information is not well-known and derives economic value � from not being well-known Reasonable efforts are taken to keep information � confidential Relatively less costly � Patents � Requires preparation of patent disclosure � Requires responses to Office Actions � Government fees (filing, issue, maintenance) � Patent applications may take a long time to issue � USPTO does have programs to shorten pendency � Uncertainty about rights of exclusivity during pendency �
Considerations for a “Hybrid” IP Approach to Green Technology � Effectiveness of type of protection over life of technology How quickly may the technology become out-dated? � How easily may the process, device, formula or � method be reversed engineered, or independently discovered? Patents exclude the practice of reverse-engineered � products or independently discovered products for a period of time Trade secrets do not provide for exclusion of reverse � engineered or independently discovered products How much movement is there among professionals in � the area of the technology? All patent applications, except those subject to a � potential §102(b) bar due to inventor’s prior publication, or prior use or sale, begin as a trade secret.
Application of a Dual Approach Coskata, www.coskata.com/process/ (last visited, February 18, 2011).
Application of a Dual Approach (Physical Component) Coskata’s U.S. Publication No. 2009/0029434
Application of a Dual Approach (Bio-Chem Component) Genes encoding key catalyzing mechanisms for ethanol production from syngas fermentation 1. An isolated polynucleotide comprising a nucleotide sequence encoding an operon that codes for carbon monoxide dehydrogenase, a membrane-associated electron transfer protein, a ferredoxin oxidoreductase, and a promoter, said sequence being at least 77% identical to atgtcaaataacaaaatttg… <i.e.SEQ ID NO. 1.> Coskata’s U.S. Publication No. 2011/0008860
Additional “Green Tech” Examples Where Dual Approach Can Be Effective Wind turbines Physical components: � Blade and head structures; devices and methods of assembly Chemical component: � Lubricants to facilitate rotation U.S. Publication No. 2010/0028152
Additional “Green Tech” Examples Where Dual Approach Can Be Effective Solar cell assemblies Physical � components: substrate arrangements, n- and p- electrode interconnections Chemical or process � component: solar photovoltaic semiconductor materials and processes for semiconductor purity U.S. Publication No. 2010/0018565
Additional “Green Tech” Examples Where Dual Approach Can Be Effective Battery Physical � components: physical cell configurations and arrangements Chemical or process � component: electrolyte materials and formulations U.S. Publication No. 2010/0003582
Patent considerations in view of trade secret disclosures In normal course, patent application will publish � within 18 months of filing, or earliest priority date Can avoid publication to maintain trade secret status � Expressly abandon the application to avoid � abandonment (37 C.F.R. 1.138(c)) File the request at least four weeks prior to expected � 18 month publication date OR File patent with non-publication request � Certify that the application has not and will not be filed in a � foreign country with an 18 month publication requirement Conspicuous and signed request for non-publication � Can retract the request for non-publication �
Patent considerations in view of trade secret disclosures During time of patent application pendency � Applicant should track time to publication � Preservation of trade secret � Avoid having its own publication hinder patentability of � improvement on original invention Applicant to evaluate relative strength of trade secret � protection vs. patent protection via continued investigations of the invention If Applicant’s continued investigations tend to move in a � different direction or yields more specific information than original patent application Applicant can continue patent protection route for current � application Applicant may also file a continuation-in-part application. Any new � disclosures of c-i-p will be held in confidentiality until publication (may occur earlier than 18 months from filing date with the priority claim to original patent) Applicant can abandon the patent protection route and maintain � trade secret
Evaluation of relative strength of trade secret protection vs. patent protection Can be difficult to evaluate if the application is filed in a � USPTO Group Art Unit with a significant examination backlog. Application may publish prior to receipt of the first Office Action May request for expedited examination by submitting � Examination Support Document with request for accelerated examination USPTO to issue a final determination within one year � Earlier issuance of a substantive rejection or an � allowance Abandonment should be affirmatively made if trade � secret to be maintained once examination under accelerated program begins
USPTO Green Tech Incentives Green Technology pilot program extended to December � 31, 2011, or when 3000 applications are accepted into program (currently, 1595 petitions have been granted). Not the same program as “accelerated examination” � Invention contributes to � � Environmental quality � Discovery or development of renewable energy resources � More efficient utilization and conservation of energy resources � Reduction of Greenhouse gas emissions Applicant must request early publication of application � May be sacrificing some trade secret protection � Applicant must agree to respond to telephone restriction, � if necessary
USPTO Green Tech Incentives � Request to participate in Green Technology Pilot must be received prior to first Office Action on merits Written Restriction/Election qualifies as a first Office Action � on merits � National stage applications qualify for pilot � Limits on claims Claims cannot exceed 3 independent claims and 20 � claims total No multiple dependent claims permitted �
USPTO Green Tech Incentives � Pilot program projected to shorten pendency cycle of application by 12 months � First Office Action on the merits usually provided within 49 days of acceptance of Petition to Make Special under Pilot program � Many applications issue within 1 year � 250 applications of 1595 granted “Green” petitions have already been passed to issue
USPTO Green Tech Incentives Tech Center Name of Technology Center Number of Petitions 1600 Biotechnology and Organic Chemistry 145 1700 Chemical and Materials Engineering 849 2100 Computer Architecture, Software, and Information Security 144 2400 Computer Networks, Multiplex Communication, Video 11 Distribution, and Security 2600 Communication 23 2800 Semiconductors, Electrical and Optical Systems and 789 Components 3600 Transportation, Construction, Electronic Commerce, 307 Agriculture, National Security, and License & Review 3700 Mechanical Engineering, Manufacturing Products 761 4100 Patent Training Academy 11 Not 61 Assigned www.uspto.gov/patent/init_events/green_tech.jsp#heading-5 (last visited April 7, 2011)
§112 Requirements to consider in a dual approach Enablement and best mode � The specification shall contain a written description of � the invention, and the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same , and shall set forth the best mode contemplated by the inventor of carrying out his invention. (35 U.S.C. § 112, first paragraph) Recent Cases � Green Edge Enterprises LLC v. Rubber Mulch 620 F3d 1287 � (Fed. Cir. 2010). Bayer AG v. Schein Pharmaceuticals, Inc., 301 F3d 1306, � 1314 (Fed. Cir. 2002). Ajinomoto Co. v. Int’l Trade Comm’n, 597 F3d 1267 (Fed. � Cir. 2010).
Satisfying Section 112 Requirements Inquiry 1: At the time the application was filed, did the � inventor possess a best mode of practicing the claimed invention? Subjective intent of inventor � Did the inventor have personal preferences as of the filing � date of the application? Inquiry 2: If the inventor had a preference, did the � inventor conceal this preferred mode from the public? Objective determination, viewed from the standpoint of one � skilled in the art In the case of proprietary information, did the inventor � adequately disclose the source and identification of materials to practice or enable the best mode? For proprietary information, must disclose manufacturer � and product name used to satisfy best mode
Recommend
More recommend
