A brief History of PCR Dr. Richard Molenkamp Medical Molecular - PowerPoint PPT Presentation

A brief History of PCR Dr. Richard Molenkamp Medical Molecular Microbiologist

Structure of DNA

Visualisation of DNA I Staining Hybridisation Direct

Visualisation of DNA II Small amounts of signal: Need amplification PCR: Polymerase Chain Reaction

Principle of PCR Conventional thermocycle profile:

Exponential amplification Number of cycli on an agarose gel: 10 15 20 25 30 35 40

Early PCR Addition of polymerase in each cycle Breakthrough: Thermostable (Taq) polymerase Integrated Thermocyclers

Conventional PCR = End point analysis no quantitative data Real-time PCR

Sybrgreen reactions - Intercalating fluorescence DNA Target Sequence Denaturation Drawback: a-specifc product also fluoresent!

Lens Dichrome Mirror MUX LASER Sample block Lens Spectrograph CCD camera

Amplification curves

Sybrgreen reactions – melting curve analysis

Detection Formats (I) Probe-based - Taqman technology: specific double-dyed fluorescent hydrolysis probes - FRET (Fluorescence Resonance Energy Transfer): hybridisation probes - Partially double stranded, single-dyed, hybridisation probes R R Q Q – Long target-specific probe w – – – – –

Excitation / emission of fluorophores TAMRA quenching Fluorescence Deep Dark/Black hole quenchers

5’ Nuclease Assay / Taqman assay F = reporter  FAM, VIC, Hex … Q = quencher  Black hole quencher (BHQ)….

Hybridization probes or FRET probes

Partially double stranded linear DNA probes R R Q Q – Long target-specific probe with fluor – Short quencher probe – Fluorescence quenched when probes are hybridized – Long probe preferentially binds target – Short quencher probe is dissociated – Fluorescence is detected Excitation Excitation Emission Emission R

Probe free: MultiCode technology (I) MultiCode Base Pair (isoC:isoG) Iso C Iso G Scott C etal, Nucl. Ac. Res. 2004

MultiCode PCR (II)

MultiCode technology

Ct / Cp / Cq Calling

Ct calling I PCR positivity measured at Cycle threshold (Ct)-level Fluorescence Threshold Cycle Background fluorescence 10x SD background 10 30 0 20 Number of cycles

Ct calling II PCR positivity measured at Cycle threshold (Ct)-level Fluorescence Threshold Cycle Background fluorescence 10x SD background 20 10 30 0 Number of cycles

Cp calling I PCR positivity measured 2 nd derivative max. Fluorescence Crossing point Calculates 2nd derivative and determines its maximum. Background fluorescence  CP: Where the rate of increase of fluorescence is greatest 10 30 0 20 Number of cycles

Cp calling II PCR positivity measured 2 nd derivative max. Fluorescence 10 30 0 20 Number of cycles

Quantification

Quantification with real-time PCR

Principles of quantification – real time PCR Calculation of efficiency

Reverse transcription PCR

Reverse transcription PCR Mix of RT and PCR enzyme: M-MLV / Taqgold Enzyme with RT and DNA pol activity rTth

Sequence variation Influences design of PCR PCR can be used to detect variation

HIV-1 group M sequence variation in Gag and Pol genes

Influence of mismatches on hybridization temperature Length 27 nt GC content 60% Tm 69 ºC tgggaggttctctccagcactagcagg Tm 62.6 ºC tgggaggttctctccagcactagcagg a t Tm 57.8 ºC tgggaggttctctccagcactagcagg a t a

How to deal with sequence variation  Degenerate oligos  GGTAYCCATGRTCAG IUB codes R = A or G Y = C or T  Dual target assay  Dual probe assay

Dual target real time PCR Genome HIV 5’ - - 3’ Integrase LTR If there is a mutation in either of the primer/probe sites  the other PCR will ‘take over‘

Realtime PCR for detection of single mutations  Conventional Sanger sequencing: ~25%  Sensitive methods:  LIPA/DNA microarray (hybridisation) 5-10%  Allele-specific PCR ~5%  Next generation sequencing (0.5% ?)  Quantitative real-time techniques: 1-10%  LNA/MGB probes (short high affinity probes)  Digital PCR

Probes used for detection of single mutations (I) Minor groove binding probes Locked nucleic acid probes • Due to higher affinity binding shorter probes can be defined • Taqman probes are 22-30 nt long; LNA/MGB probes 8-20 nt long

Hybridization temperature: effect in MGB and LNA probes Length 27 nt tgggaggttctctccagcactagcagg Tm 69 ºC tgggaggttctctccagcactagcagg Tm 62.6 ºC a t tgggaggttctctccagcactagcagg Tm 57.8 ºC a t a Length 17 nt GGAGG(+T)T(+C)TCT(+C)CAG(+C)A Tm 69 ºC GGAGG(+T)T(+C)TCT(+C)CAG(+C)A Tm 59 ºC A

Detection of oseltamivir resistant influenza A/H1N1 H274Y by real-time discrimination PCR using LNA probes T (mut) NA: 5’atcgaaaagggaaaggttactaaatcaatagagttaaatgcacccaatttt C attatgaggaatgttcctgttacccagacactggc 3’ LNA:H274Y N1274Yfpr1 N1274Yrpr1 (30bp) (24bp) LNA:H274H (16bp) Mutant cluster + control + control Wild-type cluster + control + control NTC NTC

Detection of lamivudine resistance in HBV Pas et al., Journal of Clinical Virology 32 (2005) 166 – 172

Effect of (enzyme) mastermix on mismatch tolerance

Influence of mastermix on primer bindingsite mismatch tolerance > 50 different mutants Stadhouders et al., J. Mol. Diag., 2010

Primer bindingsite mismatch tolerance

Influence of mastermix on primer bindingsite mismatch tolerance MMLV / Taqgold combination (ABI): RT @ 48°C

Influence of mastermix on primer bindingsite mismatch tolerance rTth based mastermix: RT@60°C

Digital PCR Fluidigm Biorad QX200 droplet PCR Raindance technologies Quant studio

Principle of digital PCR (dPCR) Limited dilution Poisson distribution 0 0.368 1 0.368 2 0.184 3 0.061 4 0.015 5 0.003 >5 0.001

1 1. Manual dilution 2. Droplet PCR (ddPCR, Biorad) 2 3. Lab on a chip (Lifetechnologies) 3 4. Microfluidics (Fluidigm) 4

Applications of dPCR  Rare sequence / mutation detection (oncology, virology drug resistance)  Copy number quantification (standardisation controls)  Low level pathogen detection (in difficult samples)  Gene-expression (absolute quant. of (un)stimulated) gene expression)

Questions ?