prebiotic evolution 1
play

Prebiotic Evolution 1 Life, error threshold & hypercycle Walter - PowerPoint PPT Presentation

Nov 25, 2023 •617 likes •779 views

Prebiotic Evolution 1 Life, error threshold & hypercycle Walter de Back Collegium Budapest Institute for Advanced Study - what is life? - the chemoton: tibor ganti - error threshold: catch-22 in evolution - hypercycles: coexisting

  1. Prebiotic Evolution 1 Life, error threshold & hypercycle Walter de Back Collegium Budapest Institute for Advanced Study

  2. - what is life? - the chemoton: tibor ganti - error threshold: catch-22 in evolution - hypercycles: coexisting replicators - hypercycles in space: spatial selfstructuring

  3. What is life?

  4. “What is Life today ?”

  5. metabolism boundary template Chemoton Tibor Ganti

  6. Pathways of supersystem evolution metabolism M B boundary M T M B T template B T INFRABIOLOGICAL SYSTEMS

  7. Modern life

  8. Prebiotic RNA world

  9. Nucleic Acids (DNA, RNA) Store of Biological Information “Genetic “Replication” Information” Complementary Base Pairing A U A = U G C U A G C G C RNA

  10. Error threshold AGUCUGCUAGGUAGCUAGUGAUGUAGUGCGAUG Replication Copying AGUCUGC C AGGUAGCUAGUGAUGUAGU U CGAUG G GUCUGCUAGG C AGCUAGUGAUG C AGUGCGAUG AGUCUGCUAGGUAGCUAG GC AUGUAGUGCGAUG AGUCUGCUAGGUAGCUAGUGGUAGUGCGAUG AGUCUGCUA U GUAGCUAGUGAUGUAGUGCGAUG AGUCUGCUAGGUAGC C AGUGAUGUAGUGCGAUG AGUCUGCUAGGUAGCUAGUGAUGUAGUGCGA G UG AGUCUGCUAGGUAGCUAGUGAUGUAGUGCG UC G A U UCUGCUAGGUA C CUAGUGAUGUAGUGCGAUG AGUCUGCUAGGUAGCU C AGUGAUGUAGUGCGAUG

  11. Error threshold AGUC Replication Copying AGUC G GUC AGUC AGUC AGUC AGUC AGUC AGUC A U UC AGUC

  12. Quasi-species and error threshold

  13. No genome without enzymes, and no enzyme without genomes

  14. Cooperation of unlinked genes the hypercycle

  15. Hypercyles on a surface

Recommend

Discovery of a novel thermophile -galactosidase, Tt bGal1, for the production of prebiotic

Discovery of a novel thermophile -galactosidase, Tt bGal1, for the production of prebiotic

Discovery of a novel thermophile -galactosidase, Tt bGal1, for the production of prebiotic oligosaccharides from acid whey Zerva, A. 1 , Limnaios, A. 2 , Taoukis, P. 2 , Topakas, E 1 . 1 Biotechnology Laboratory, School of Chemical Engineering,

365 views • 15 slides
Lecture 4: The Rise of Atmospheric O 2 and O 2 The prebiotic atmosphere/ Cyanobacteria/ The rise

Lecture 4: The Rise of Atmospheric O 2 and O 2 The prebiotic atmosphere/ Cyanobacteria/ The rise

41st Saas-Fee Course From Planets to Life 3-9 April 2011 Lecture 4: The Rise of Atmospheric O 2 and O 2 The prebiotic atmosphere/ Cyanobacteria/ The rise of O 2 and O 3 / Sulfur MIF J. F. Kasting Strongly and weakly reducing atmospheres

586 views • 34 slides
Lecture 5: Hydrogen Escape, Part 1 Prebiotic O 2 levels/ Kinetic theory of gases/ Jeans

Lecture 5: Hydrogen Escape, Part 1 Prebiotic O 2 levels/ Kinetic theory of gases/ Jeans

41st Saas-Fee Course From Planets to Life 3-9 April 2011 Lecture 5: Hydrogen Escape, Part 1 Prebiotic O 2 levels/ Kinetic theory of gases/ Jeans escape/ Nonthermal escape J. F. Kasting Why do we care about hydrogen escape? Most H

752 views • 31 slides
EVOLUTION X3 - 1 - Evolution X3 Marketing Dpt. November 2006 - 2 - EVOLUTION X3 Evolution X3

EVOLUTION X3 - 1 - Evolution X3 Marketing Dpt. November 2006 - 2 - EVOLUTION X3 Evolution X3

Marketing Dpt. November 2006 EVOLUTION X3 - 1 - Evolution X3 Marketing Dpt. November 2006 - 2 - EVOLUTION X3 Evolution X3 Evolution X3 Technical Features: HP Pum p Highly reliable plunger pump with brass head and 3 ceramic pistons for

405 views • 13 slides
1 MICROEVOLUTION: change in the properties of populations of organisms over the course of

1 MICROEVOLUTION: change in the properties of populations of organisms over the course of

Introduction to Molecular Evolution (BIOL 3046) Course website: www.biol3046.info What is evolution? Evolution: from Latin evolvere , to unfold broad sense, to change e.g., stellar evolution, cultural evolution,

518 views • 6 slides
Rehabilitation Consequences of Road Collisions ine Carroll Evolution Evolution Evolution

Rehabilitation Consequences of Road Collisions ine Carroll Evolution Evolution Evolution

Rehabilitation Consequences of Road Collisions ine Carroll Evolution Evolution Evolution Exoskeleton Endoskeleton Soft and squishy! Lascaux Consequences Pedestrian RTCs Brain Spinal cord injury Common Clinical Patterns Upper Limbs

706 views • 54 slides
EVOLUTION Paper 2: 66 marks THEORIES OF EVOLUTION EVOLUTION : Change over Time Compiled by

EVOLUTION Paper 2: 66 marks THEORIES OF EVOLUTION EVOLUTION : Change over Time Compiled by

EVOLUTION Paper 2: 66 marks THEORIES OF EVOLUTION EVOLUTION : Change over Time Compiled by Mr G. D. MABOTE C.O.P. Member in the NORTHERN CAPE PROVINCE A former Lecturer at THE NATIONAL INSTITUTE FOR HIGHER EDUCATION DEFINE EACH OF THESE

467 views • 29 slides
The Evolution of Subsidies Disciplines in The Evolution of Subsidies Disciplines in GATT and the

The Evolution of Subsidies Disciplines in The Evolution of Subsidies Disciplines in GATT and the

IIBE&L Evolution of Subsidies Disciplines Seminar Washington, DC 15 February 2006 Institute for International Business, Economics & Law The University of Adelaide, Australia The Evolution of Subsidies Disciplines in The Evolution

562 views • 41 slides
Evolution Change over time but what is the process? Evolution: Change through time

Evolution Change over time but what is the process? Evolution: Change through time

Evolution Change over time but what is the process? Evolution: Change through time Unrolling Lamarckian No extinction Evolution by Natural Selection Charles Darwin Alfred Russel Wallace Evolution by Natural

1.11k views • 33 slides
Extinction What is evolution? What is evolution? The change in the genetic makeup of a

Extinction What is evolution? What is evolution? The change in the genetic makeup of a

Origins of Life and Extinction What is evolution? What is evolution? The change in the genetic makeup of a population over time Evolution accounts for the diversity of life on Earth Natural selection is the major driving mechanism

656 views • 37 slides
Extinction What is evolution? What is evolution? The change in the genetic makeup of a

Extinction What is evolution? What is evolution? The change in the genetic makeup of a

Origins of Life and Extinction What is evolution? What is evolution? The change in the genetic makeup of a population over time Evolution accounts for the diversity of life on Earth Natural selection is the major driving mechanism

452 views • 34 slides
Galaxy Evolution interstellar matter (ISM) drives galaxy evolution, but SFR evolution driven

Galaxy Evolution interstellar matter (ISM) drives galaxy evolution, but SFR evolution driven

Galaxy Evolution interstellar matter (ISM) drives galaxy evolution, but SFR evolution driven by gas supply ?? starburst vs main sequence ?? need to measure the mass of ISM gas or dust CO / long dust em. w/ ALMA high J CO ??

416 views • 38 slides
Karl Sims and the Digital Evolution (Co-)Evolution of Morphologies and Behavior

Karl Sims and the Digital Evolution (Co-)Evolution of Morphologies and Behavior

Karl Sims and the Digital Evolution (Co-)Evolution of Morphologies and Behavior Aesthetic (Graphics) Complex behavior Natural Morphology CPSC 607 In Class Presentation Russel Ahmed Apu Building Blocks of Evolution

293 views • 4 slides
Chapter: 12 12 HSPA Evolution HSPA Evolution Ruiyuan Tian Department of Electrical and

Chapter: 12 12 HSPA Evolution HSPA Evolution Ruiyuan Tian Department of Electrical and

3G Evolution Chapter: 12 12 HSPA Evolution HSPA Evolution Ruiyuan Tian Department of Electrical and Information Technology p gy 2009-04-02 3G Evolution - HSPA and LTE for Mobile Broadband 1 Outline Introduction Evolved Features

319 views • 28 slides
Technology Evolution Technology Focused Evolution Architectural Changes Impact on

Technology Evolution Technology Focused Evolution Architectural Changes Impact on

Introduction - Products Product Evolution Market Focused Evolution New Features Improvements Technology Evolution Technology Focused Evolution Architectural Changes Impact on Architecture of a Technology

421 views • 11 slides
The Generalized Theories of Evolution Why it is the Theory of Evolution that is Constantly

The Generalized Theories of Evolution Why it is the Theory of Evolution that is Constantly

The Generalized Theories of Evolution Why it is the Theory of Evolution that is Constantly Generalized? Ozan Altan Altinok The Generalized Theories of Evolution Outline - Introduction: Too quick generalizations? r: - Evolution, theories,

336 views • 22 slides
Meta-Evolution Style for Software Architecture Evolution lah Ad Adel Ha Hassan n and Mourad d

Meta-Evolution Style for Software Architecture Evolution lah Ad Adel Ha Hassan n and Mourad d

Meta-Evolution Style for Software Architecture Evolution lah Ad Adel Ha Hassan n and Mourad d Oussalah SOFSEM 2016 1 Harrachov, Czech Republic Outline Motivation Preliminaries Evolution styles Meta-evolution style

554 views • 18 slides
1 molecular evolution molecular phylogenetics evolution of molecules genomics bioinformatics

1 molecular evolution molecular phylogenetics evolution of molecules genomics bioinformatics

Introduction to Molecular Evolution (BIOL 3046) Course website: www.biol3046.info What is molecular evolution? = process + outcome Organism diversity: Population Populations genetics Species Above Molecular biology Genetic diversity

332 views • 10 slides
Evolution and Co-Evolution of Computer Programs to Control Independently-Acting Agents John R.

Evolution and Co-Evolution of Computer Programs to Control Independently-Acting Agents John R.

Evolution and Co-Evolution of Computer Programs to Control Independently-Acting Agents John R. Koza Presented by MinHua Huang Outline Introduction Genetic Programming Paradigm 3 examples - Artificial Ant - Differential Game - Co-Evolution

760 views • 27 slides
Evolution of convective of convective cloud cloud top top height height: : Evolution

Evolution of convective of convective cloud cloud top top height height: : Evolution

Jean-Marcel Piriou Centre National de Recherches Mtorologiques Groupe de Modlisation pour lAssimilation et la Prvision Evolution of convective of convective cloud cloud top top height height: : Evolution Evolution of convective

304 views • 28 slides
1. Evolution and Classification 1.1 Origin of Life and Plants 1.2 Animal Evolution 1.3 Human

1. Evolution and Classification 1.1 Origin of Life and Plants 1.2 Animal Evolution 1.3 Human

1. Evolution and Classification 1.1 Origin of Life and Plants 1.2 Animal Evolution 1.3 Human Evolution 1.4 Mechanisms of Evolution 1.5 Hardy-Weinberg Equilibrium 1.6 Mechanisms of Speciation 1.7 Classification of Living Organisms 1.1

920 views • 79 slides
Models of Language Evolution models thereof its evolution language Models of Language Evolution

Models of Language Evolution models thereof its evolution language Models of Language Evolution

Models of Language Evolution models thereof its evolution language Models of Language Evolution ? What is language? never start with a dictionary definition!! the language of Google search query completion A language is a dialect with

1.13k views • 30 slides
Evidence for Evolution Scientific evidence of biological evolution uses information from

Evidence for Evolution Scientific evidence of biological evolution uses information from

Evidence for Evolution Scientific evidence of biological evolution uses information from geographical, geological, physical, chemical and mathematical applications. 1.A.4 Evidence of Biological Evolution Geographic Distribution of

440 views • 43 slides
Competitive and Cooperative Co Evolution Co-Evolution Companion slides for the book Bio-Inspired

Competitive and Cooperative Co Evolution Co-Evolution Companion slides for the book Bio-Inspired

Competitive and Cooperative Co Evolution Co-Evolution Companion slides for the book Bio-Inspired Artificial Intelligence: Theories, 1 Methods, and Technologies by Dario Floreano and Claudio Mattiussi, MIT Press COMPETITIVE CO-EVOLUTION Companion

932 views • 35 slides

More recommend