mtdnaprofiler
play

mtDNAprofiler A web based Program for Nomenclature and Comparison - PDF document

Mar 09, 2023 •39 likes •119 views

mtDNAprofiler A web based Program for Nomenclature and Comparison of mtDNA Sequences In Seok Yang Dept. of Forensic Medicine Yonsei University College of Medicine Human mitochondrial DNA (mtDNA) Characteristics 16,569 base pair,

  1. mtDNAprofiler A web based Program for Nomenclature and Comparison of mtDNA Sequences In Seok Yang Dept. of Forensic Medicine Yonsei University College of Medicine Human mitochondrial DNA (mtDNA)  Characteristics – 16,569 base pair, circular DNA p – Maternal inheritance, high mutation rate, high copy number, lack of recombination – Certain mutations in mtDNA  diseases or clinical phenotypes  Applications – Population genetics  genetic difference among populations – Medical genetics  diseases related with mtDNA variations – forensic genetics  personal identification Page  2 1

  2. Human mtDNA analysis from samples Experiment 1 Experiment 2 Difficult points Assembly from several fragment DNA extraction DNA extraction sequences to single consensus sequence PCR PCR Sequencing Sequencing Comparison with rCRS  Alignment with rCRS Sequence analysis Sequence analysis  Description of different site (mtSNP) Unfamiliar with mtDNA nomenclature Several nomenclature rules proposed Comparison between two mtSNP data Comparison of data in a FASTA format or in mtSNP format Final mtSNP data Page  3 Nomenclature : mtDNA seq  mtSNP Sequence >Sample AACAAACCTATCCACCCTTAACAGTACATAGTACATAAAACCATT AACAAACCTATCCACCCTTAACAGTACATAGTACATAAAACCATT TACCGTACATAGCACATTACAGTCAAATCCCTTCTCGCCCCCATG Alignment with rCRS 16280.....16290.....16300.....16310.....16320.....16330.....16340.....16350.....16360..... ▼ _________ ▼ _________ ▼ _________ ▼ _________ ▼ _________ ▼ _________ ▼ _________ ▼ _________ ▼ _________ rCRS AACAAACCTA C CCACCCTTAACAGTACATAGTACATAAA G CCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCG T CCCCATG .......... S ............................ S .......................................... S ....... Sample p AACAAACCTA T CCACCCTTAACAGTACATAGTACATAAA A CCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCG C CCCCATG mtSNP Sample 16290T 16319A 16362C Page  4 2

  3. mtDNAprofiler (http://mtprofiler.yonsei.ac.kr)  Four tools Main menus 1. mtDNA nomenclature 2. mtDNA assembly 2 tDNA bl 3. mtSNP conversion Each tool 4. mtSNP comparison  Development 1. Web environment 2. Language : PHP g g 3. Operating system : Linux Input format 4. Web-service program : Apache HTTP server Page  5 Sample sequences  FASTA format Electropherogram profile Sample sequences in FASTA format Page  6 3

  4. mtDNA nomenclature protocol 1. Alignment in mtDNAprofiler basically 1. Least number of differences uses parsimonious Smith-Waterman algorithm and follows alignment 2. Indels detection and rearrangement 2. Indels detection and rearrangement rules which is selected by scientific working group on DNA analysis a. AC repeat region methods (SWGDAM). Maintain repeat unit 2. Its protocol is composed of two main b. Hypervariable 2 C-stretch region rules as following: least number of (1) Prefer indels to substitutions differences and indels (insertions and deletions) detection and (2) 3’-most placement of indels rearrangement. rearrangement c. Non-AC repeat & non-hypervariable 2 C-stretch region 3. Second rule is further divided into (1) Prefer substitutions to indels three sub-rules, which selects one (2) 3’-most placement of indels rule according to the region. (3) Contiguous placement of indels Page  7 1. mtDNA nomenclature tool Input sequences mtDNA nomenclature tool is designed to in FASTA format provide users with mtSNP data through Start page automated alignment of mtDNA sequences with rCRS. Range Alignment result Mini-map Mi i mtSNP profile Input sequence Page  8 Result page 4

  5. Download button Alignment results in a new window mtSNP profile in a new window mtSNP frequency in a new window mtSNP profile in downloaded file Page  9 Download buttons 2. mtDNA Assembly assembly tool overview The mtDNA assembly tool extracts a consensus sequence from several Mini-map Assembly detail mtDNA fragment sequences obtained from multiple amplification reactions. mtSNP profile Alignment detail Input sequences in FASTA format Start page Two candidates of assembled sequences Page  10 Result page 5

  6. Protocols of two mtSNP tools - mtSNP conversion and comparison tools Data set 1 Data set 2 mtSNP comparison Original mtSNP 1 Original mtSNP Converted FASTA Converted FASTA mtSNP mtSNP 2 3 sequence sequence comparison comparison Re-calculated mtSNP Re-calculated mtSNP mtSNP conversion tool mtSNP comparison tool mtSNP conversion tool : mtSNP list  nucleotide sequence in FASTA format 1. 2. mtSNP comparison tool : Comparison function between two mtSNP data gathered from independent two experments 3. Both tools have validity checkup function for the mtSNP in comparison with original input mtSNP and re-calculated mtSNP . Page  11 Download button 3. mtSNP conversion tool Included mtSNPs 1 Alignment result 1 Included mtSNPs 2 Included mtSNPs 2 Range selection Alignment  mtDNAmanager result 2 format or Excluded mtSNPs  EMPOP format Result page (Tab1 – alignment with rCRS)  Tab2 – Converted FASTA Start page – single data set input Start page single data set input sequences The mtDNA assembly tool extracts a  Tab3 – consensus sequence from several Validity mtDNA fragment sequences obtained Original checkup of mtSNP Re-calculated from multiple amplification reactions. Original Page  12 Re-calculated 6

  7. Direct comparison 4. mtSNP result between two original mtSNP data comparison tool * * Data set 1 Data set 1 mtDNAmanager format or EMPOP format Start page – two data sets input Result page (Tab1 – alignment with rCRS) mtSNP comparison tool provides comparison results between two mtSNP data gathered from independent two experiments for the same sample. Page  13 Tab2 – Validity checkup of mtSNP Conclusion 1. The description and analysis of mtDNA sequence variations compared to rCRS can be easily carried out using mtDNA nomenclature tool of mtDNAprofiler. mtDNAprofiler 2. mtDNA assembly tool allows users to extract a consensus sequence from several fragment sequences of mtDNA. 3. mtSNP conversion and comparison tools help users to compare and manage the mtSNP data gathered by two independent experiments. the mtSNP data gathered by two independent experiments 4. Therefore, mtDNAprofiler is a useful program to characterize and analyze mtDNA sequences for researcher dealing with mtDNA. Page  14 7

  8. Thank you 8

Recommend

More recommend