GENOME 541 Syllabus ! protein and DNA sequence analysis to - PDF document

GENOME 541 Syllabus ! “… protein and DNA sequence analysis … to Modeling and Searching 
 determine the "periodic table of biology," i.e., for Non-Coding RNA � the list of proteins …, which can be regarded as the first stage in…” ! W.L. Ruzzo ! http://www.cs.washington.edu/homes/ruzzo No mention of RNA… ! http://www.cs.washington.edu/homes/ruzzo/ courses/gs541/10sp The Message ! Rough Outline ! noncoding RNA ! Cells make lots of RNA ! Today ! Noncoding RNA Examples ! RNA structure prediction ! Functionally important, functionally diverse ! Lecture 2 ! RNA “motif” models ! Structurally complex ! Search ! Lecture 3 ! New tools required ! Motif discovery ! ! alignment, discovery, search, scoring, etc. ! Applications ! 10 17 RNA ! DNA: DeoxyriboNucleic Acid ! RNA: RiboNucleic Acid ! Like DNA, except: ! pairs ! Lacks OH on ribose (backbone sugar) ! with A ! Fig. 2 . The arrows show the situation as it seemed in 1958. Solid arrows represent Uracil (U) in place of thymine (T) ! probable transfers, dotted arrows possible transfers. The absent arrows (compare Fig. 1) A, G, C as before ! represent the impossible transfers postulated CH 3 ! by the central dogma. They are the three possible arrows starting from protein. ! thymine ! uracil ! 18

RNA Secondary Structure: " “Classical” RNAs ! RNA makes helices too ! rRNA - ribosomal RNA (~4 kinds, 120-5k nt) ! U � C � A � A � tRNA - transfer RNA (~61 kinds, ~ 75 nt) ! C � G � Base pairs � RNaseP - tRNA processing (~300 nt) ! G � C � A � snRNA - small nuclear RNA (splicing: U1, etc, 60-300nt) ! G � C � A � U � U � A � C � G � C � G � a handful of others ! A � U � U � G � G � C � 5´ � A � 3´ � A � A � A � C � U � Usually single stranded ! 26 Proteins Bacteria ! catalyze & Triumph of proteins ! regulate ~ 80% of genome is coding DNA ! biochemistry ! Functionally diverse ! ! receptors ! ! motors ! ! catalysts ! ! regulators (Monod & Jakob, Nobel prize 1965) ! ! … ! 28 29 Not the only way! ! Not the only way! ! Alberts, et al, 3e. Alberts, et al, 3e. Riboswitch Riboswitch Protein Protein alternative alternatives way way SAM-II ! SAM ! SAM-I ! Grundy & Henkin, Mol. Microbiol 1998 Epshtein, et al., PNAS 2003 Corbino et al., Winkler et al., Nat. Struct. Biol. 2003 Genome Biol. 2005 Grundy, Epshtein, Winkler 34 35 et al., 1998, 2003

Not the only way! ! Not the only way! ! Alberts, et al, 3e. Alberts, et al, 3e. Riboswitch Riboswitch Protein Protein alternatives alternatives way way SAM-III ! SAM-III ! SAM-I ! SAM-II ! SAM-I ! SAM-II ! SAM-IV ! Fuchs et al., NSMB 2006 Grundy, Epshtein, Winkler Corbino et al., Grundy, Epshtein, Winkler Corbino et al., Fuchs et al., Weinberg et al., 36 37 et al., 1998, 2003 et al., 1998, 2003 Genome Biol. 2005 Genome Biol. 2005 NSMB 2006 RNA 2008 Not the only way! ! Alberts, et al, 3e. Riboswitch Protein alternatives way SAM-III ! SAM-I ! SAM-II ! SAM-IV ! Grundy, Epshtein, Corbino et Fuchs Weinberg Meyer, etal., BMC Winkler al., et al., et al., Genomics 2009 et al., 1998, 2003 Genome NSMB RNA 2008 Biol. 2005 2006 38 39 Riboswitches ! ~ 20 ligands known; multiple nonhomologous solutions for some ! dozens to hundreds of instances of each ! TPP known in archaea & eukaryotes ! one known in bacteriophage ! on/off; transcription/translation; splicing; combinatorial control ! In some bacteria, more riboregulators identified than protein TFs ! all found since ~2003 ! 40

ncRNA Example: T-boxes ! 58 6S mimics an " ncRNA Example: 6S ! open promoter ! medium size (175nt) ! structured ! Bacillus/ " Clostridium ! highly expressed in E. coli in certain growth conditions ! Actino- sequenced in 1971; function unknown for 30 bacteria ! years ! E.coli Barrick et al. RNA 2005 Trotochaud et al. NSMB 2005 Willkomm et al. NAR 2005 64 a Vol 462 | 3 December 2009 | doi:10.1038/nature08586 RNAs of 73% R RG A A A C A R Y G U U G R R R Y U G A 0–14 nt LETTERS unusual size 7% Y CG C U G G C GA A AG G Y R Y A G C C G C A Y C U G R Y R A G C G A A A C U G and A C R G C C Exceptional structured noncoding RNAs revealed by Y 0–10 nt 1–6 nt Y G bacterial metagenome analysis Y R UR AR R Y HEARO complexity ! U A A G UG 1–2 nt 1–9 nt Y Zasha Weinberg 1,2 , Jonathan Perreault 2 , Michelle M. Meyer 2 & Ronald R. Breaker 1,2,3 0–39 nt C G Y Y R U A UC GYY Y Y Pseudoknot U A C ACG CAU Y Y Y Y C U 23S rRNA Y C R G R R R Ribozyme R C U U A A U C 0–18 nt Y G A 0–11 nt 3 ′ Not ribozyme R Multistem junctions plus pseudoknots 1–58 nt integration 16S rRNA site Unknown function G CG A R G Group II intron 5 ′ R R R ORF A U G A 3 ′ 5 ′ A 0–7 nt 0–17 nt integration Y 0–1490 nt G C site GOLLD 10 U A tmRNA C G A U HEARO R Y AdoCbl Y G riboswitch RNase P R U C C C C R A 0–70 nt HEARO AA OLE G G G GC glmS U Stem usually ribozyme Group I intron U has A bulge or A-C mismatch IMES-1 IMES-2 Lysine riboswitch b 149530 151150 A. variabilis ACAAAATATATTACTCAACTGTCAG ATGAGCCAAAAACGCGAACTAGAA 1 100 1,000 75790 Average size (nucleotides) Nostoc sp. 65 ACAAAATATATCACTCAACTATGAGCCAAAAACGCGAACTAGAA 66 |

! RNAs of a G R R U AAA C AARC C R C Y A Y G A A A A G G G U C A R RR A U G A G C Pseudoknot U G Y A unusual GOLLD R Y G Y A U Y R A GRY C Y R Y Y Y Y Y G CA R C G R R R R U R U R R RA A RU R Y Y R Y UA Y R R C C A Y A A A U R A C G UGY RA Y R abundance ! Pseudoknot 0–2 nt Y Y U U Y R Y A U A U C U U A Y R G G C U A G C G C E-loop Y R Y G R G A A R C U G R G R Y R AGRR G R R E-loop A A A G G CA 5 ′ U G Y G G C AR A U R Y AU G CA R R R G G Y U G 3 nt R G Y R A A R U C A A U G G Y R R U Y Y Y C C R More abundant than 5S rRNA ! Y U A C R Y Y R R Y G Y A R R R R Pseudoknot Y A G A R Y A Y 0–3 nt R R A U A AR From unknown marine organisms ! 0–2 nt U G Pseudoknot C G A Y Y A R R R Y R C Y A U Y R R Y G R R A G C U A G Y R R Y Y Y R G R R RA G G Y R Y A Y R R U GG R R R R G R G R A R UG C A R A A A G A A A A G U Y Y Y R A G Y G R Y A CAAU Y G R RUUG A G U 0–129 nt C G CU R R Y G R G (can contain tRNA) U A C U A C R U A Y A G A G G A Y Y A U U G 1–2 nt G R R U YR GR A A A 0–7 nt G C C A U G G R C 3 ′ U R Y Y Y 0–2 nt R: A or G, Y: C or U. Y C U AC 7 or 8 nt AA G G U R Y G nt: nucleotides A R A C CUU Y AR UG A Y A G Pseudoknot R C U Y R Base pair annotations Nucleotide C G Y R U A U A G AA Covarying mutations identity C U U U Y Compatible mutations N 97% A 0–22 Y R No mutations observed A nt N 90% G U U UA A N 75% U b No treatment Mitomycin C C G Zero-length connector R U Fraction of maximum Bacterial cell density Variable-length region G C 1 G G GOLLD RNA Variable-length loop UG GU Nucleotide present Variable-length hairpin 0.5 97% 75% Modular sub-structure 90% 50% 0 GOLLD phage genomic DNA GOLLD phage genomic DNA Hours 0 2 4 6 8 10 12 14 22 2 4 6 8 10 12 14 22 67 68 ! ! | � Summary: RNA in Bacteria ! Vertebrates ! Widespread, deeply conserved, structurally Bigger, more complex genomes ! sophisticated, functionally diverse, biologically <2% coding ! important uses for ncRNA throughout prokaryotic world. ! But >5% conserved in sequence? ! Regulation of MANY genes involves RNA ! And 50-90% transcribed? ! In some species, we know identities of more ribo- And structural conservation, if any, invisible regulators than protein regulators ! Dozens of classes & thousands of new examples in (without proper alignments, etc.) ! just last 5 years ! What’s going on? ! Vertebrate ncRNAs ! MicroRNA ! mRNA, tRNA, rRNA, … of course ! 1st discovered 1992 in C. elegans ! 2nd discovered 2000, also C. elegans ! and human, fly, everything between ! PLUS: ! 21-23 nucleotides ! literally fell off ends of gels ! snRNA, spliceosome, snoRNA, teleomerase, Hundreds now known in human ! microRNA, RNAi, SECIS, IRE, piwi-RNA, may regulate 1/3-1/2 of all genes ! XIST (X-inactivation), ribozymes, … ! development, stem cells, cancer, infectious diseases,… ! 77 79