computa on through dynamics
play

Computa(on through dynamics Using recurrent neural networks to - PowerPoint PPT Presentation

Feb 21, 2023 •503 likes •1.57k views

Computa(on through dynamics Using recurrent neural networks to unveil mechanism in neural circuits David Sussillo with Valerio Mante and Bill Newsome Table of contents Introduc(on Training recurrent neural networks(RNNs) Understanding how

  1. Fixed points make a line amractor choice color le; choice choice right

  2. Two line amractors for two contexts context sensory evidence color e c i o h c motion The line amractors are context dependent and never exist at the same (me.

  3. Fixed points make a line amractor choice color le; choice choice right

  4. A simulated perturba(on experiment choice color context le; choice right

  5. A simulated perturba(on experiment choice color context le; choice right

  6. A simulated perturba(on experiment choice color context le; choice right

  7. A simulated perturba(on experiment choice color context le; choice right

  8. A simulated perturba(on experiment choice color context le; choice right

  9. A simulated perturba(on experiment choice color context le; choice right

  10. A simulated perturba(on experiment choice color context le; choice right

  11. A simulated perturba(on experiment choice color context le; choice right

  12. A simulated perturba(on experiment choice color context le; choice right

  13. A simulated perturba(on experiment choice color context le; choice right

  14. So what causes this difference between integra(on of color and ignoring mo(on? choice color context le; choice right

  15. Projec(ons onto the line amractor

  17. These vectors we’ve talked about are context independent

  19. The dynamics are context dependent

  20. The dynamics are context dependent

  21. The dynamics are context dependent

  22. The dynamics are context dependent

  23. The dynamics are context dependent

  24. The dynamics are context dependent

  25. The dynamics are context dependent

  26. The dynamics are context dependent

  27. The dynamics are context dependent

  28. The dynamics are context dependent

  29. The dynamics are context dependent

  30. The dynamics are context dependent

  31. The dynamics are context dependent

  32. The dynamics are context dependent

  33. Flexible selec(on and integra(on

Recommend

DistributedAlgorithms computa@onandmessagedelivery Asynchronous PART

DistributedAlgorithms computa@onandmessagedelivery Asynchronous PART

3/4/09 Distributed AsynchronousSystems Bertinoro, March 2009 Algorithms Part II 2 Synchronous lockstepsynchrony,rounds DistributedAlgorithms computa@onandmessagedelivery

242 views • 22 slides
Randomness and quantum computa/on Computability and the BSS

Randomness and quantum computa/on Computability and the BSS

Randomness and quantum computa/on Computability and the BSS model, Hiddensee, August 9 , 2016 Andr Nies University of Auckland

652 views • 37 slides
Introduc)onto Computa)onal LexicalSeman)cs BillMacCartney

Introduc)onto Computa)onal LexicalSeman)cs BillMacCartney

Introduc)onto Computa)onal LexicalSeman)cs BillMacCartney CS224U,Lecture2 StanfordUniversity 12January2012 [slidesadaptedfromDanJurafsky] Outline 1)

936 views • 75 slides
The Computa,onal Requirements of Centralized RAN Matthew C. Valenti,

The Computa,onal Requirements of Centralized RAN Matthew C. Valenti,

The Computa,onal Requirements of Centralized RAN Matthew C. Valenti, West Virginia University Joint work with Peter Rost, Nokia Networks Aleksandra Checko, MTI Radiocomp Main Question Addressed in this Talk In a

356 views • 32 slides
Computa@onal Frameworks for Seman@c Analysis and Wikifica@on

Computa@onal Frameworks for Seman@c Analysis and Wikifica@on

Computa@onal Frameworks for Seman@c Analysis and Wikifica@on Dan Roth Department of Computer Science University of Illinois at Urbana-Champaign With

757 views • 58 slides
Web Dynamics Part 1 - Introduction 1.1 Dimensions of dynamics in the Web 1.2 Application

Web Dynamics Part 1 - Introduction 1.1 Dimensions of dynamics in the Web 1.2 Application

Web Dynamics Part 1 - Introduction 1.1 Dimensions of dynamics in the Web 1.2 Application examples Summer Term 2010 Web Dynamics 1-1 Why Web Dynamics? From Wikipedia: In physics the term dynamics customarily refers to the time evolution of

440 views • 42 slides
Mul$-scale Computa$onal Explora$on of Two-Dimensional Materials

Mul$-scale Computa$onal Explora$on of Two-Dimensional Materials

Mul$-scale Computa$onal Explora$on of Two-Dimensional Materials in Nanofluidics and DNA Sequencing PI: Narayana R. Aluru Presenter: Yanbin Wu Department

561 views • 11 slides
WHY? 1 26/01/18 1. Can be used to simulate molecular motion in a viscous medium, without

WHY? 1 26/01/18 1. Can be used to simulate molecular motion in a viscous medium, without

26/01/18 ADVANCED TECHNIQUES (MC/MD) A (seemingly) random selection. Daan Frenkel Beyond Newtonian MD 1. Langevin dynamics 2. Brownian dynamics 3. Stokesian dynamics 4. Dissipative particle dynamics 5. Etc. etc. WHY? 1 26/01/18 1. Can be used

994 views • 48 slides
10-601 Machine Learning HMM applica)ons in computa)onal biology Central

10-601 Machine Learning HMM applica)ons in computa)onal biology Central

10-601 Machine Learning HMM applica)ons in computa)onal biology Central dogma CCTGAGCCAACTATTGATGAA DNA transcription mRNA CCUGAGCCAACUAUUGAUGAA translation Protein PEPTIDE 2 Biological data

869 views • 45 slides
Feb 18, 2015 Supported by EU FP7-IRSES projects Computa(onal Intelligence

Feb 18, 2015 Supported by EU FP7-IRSES projects Computa(onal Intelligence

A Brief Introduction Feb 18, 2015 Supported by EU FP7-IRSES projects Computa(onal Intelligence Lab (CIL) EYE2E (269118), LIVCODE (295151) University of Lincoln and HAZCEPT (318907). United

659 views • 17 slides
Computa(onal and Policy Tools for Reproducible Research Roger

Computa(onal and Policy Tools for Reproducible Research Roger

Computa(onal and Policy Tools for Reproducible Research Roger D. Peng, PhD Department of Biosta/s/cs Johns Hopkins Bloomberg School of Public Health July

608 views • 46 slides
WHY? 1 17/01/17 1. Can be used to simulate molecular motion in a viscous medium, without

WHY? 1 17/01/17 1. Can be used to simulate molecular motion in a viscous medium, without

17/01/17 ADVANCED TECHNIQUES (MC/MD) A (seemingly) random selection. Daan Frenkel U. Cambridge 13/01/2017 But first: beyond Newtonian MD 1. Langevin dynamics 2. Brownian dynamics 3. Stokesian dynamics 4. Dissipative particle dynamics 5. Etc.

696 views • 47 slides
Mo#f discovery Morgane Thomas-Chollier Computa)onal systems

Mo#f discovery Morgane Thomas-Chollier Computa)onal systems

Mo#f discovery Morgane Thomas-Chollier Computa)onal systems biology - IBENS mthomas@biologie.ens.fr M2 Computa6onal analysis of cis-regulatory sequences

527 views • 41 slides
WHY? 1 <latexit

WHY? 1 <latexit

15/01/19 ADVANCED TECHNIQUES (MC/MD) A (seemingly) random selection. Daan Frenkel Beyond Newtonian MD 1. Langevin dynamics 2. Brownian dynamics 3. Stokesian dynamics 4. Dissipative particle dynamics 5. Etc. etc. WHY? 1 <latexit

818 views • 53 slides
Web Dynamics Part 1 Introduction 1.1 Dimensions of dynamics in the Web 1.2 Application examples

Web Dynamics Part 1 Introduction 1.1 Dimensions of dynamics in the Web 1.2 Application examples

Web Dynamics Part 1 Introduction 1.1 Dimensions of dynamics in the Web 1.2 Application examples Summer Term 2009 Web Dynamics 1 1 Why Web Dynamics? From Wikipedia: In physics the term dynamics customarily refers to the time evolution of

608 views • 35 slides
Complemen(ng*Computa(on*with* Visualiza(on*in*Genomics* March*11,*2010*

Complemen(ng*Computa(on*with* Visualiza(on*in*Genomics* March*11,*2010*

British Columbia Cancer Agency Genome Sciences Centre Vancouver . British Columbia . Canada Complemen(ng*Computa(on*with* Visualiza(on*in*Genomics* March*11,*2010* EBI*Interfaces*Interest*Forum* Cydney*Nielsen* Discovery*path*

483 views • 45 slides
Integr grate ted C Computa tatio tional Ma l Materia ials ls Science & Sc &

Integr grate ted C Computa tatio tional Ma l Materia ials ls Science & Sc &

Integr grate ted C Computa tatio tional Ma l Materia ials ls Science & Sc & Engineering ( (IC ICMSE SE ) ) Appr pproache hes t to Problems wi with h Evolving D Domai mains Somnat nath G h Ghosh Depar De artments

651 views • 37 slides
CSSE132 Introduc0on to Computer Systems 12 : Computa,onal model

CSSE132 Introduc0on to Computer Systems 12 : Computa,onal model

Adapted from Carnegie Mellon 15-213 CSSE132 Introduc0on to Computer Systems 12 : Computa,onal model March 21, 2013 1 Today: Computa0onal Model Basic structures

235 views • 7 slides
Systema(c Explora(on of Computa(onal Music Structure Research Oriol

Systema(c Explora(on of Computa(onal Music Structure Research Oriol

Systema(c Explora(on of Computa(onal Music Structure Research Oriol Nieto Juan Pablo Bello New York City, NY, USA August 10th, 2016 Outline - MIR task:

409 views • 16 slides
Towards a Computa.onal Poe.cs: Some Features of Nineteenth-Century Poe.c Style Natalie M.

Towards a Computa.onal Poe.cs: Some Features of Nineteenth-Century Poe.c Style Natalie M.

Towards a Computa.onal Poe.cs: Some Features of Nineteenth-Century Poe.c Style Natalie M. Houston University of MassachuseBs Lowell @nmhouston | nmhouston@gmail.com sociological poe.cs seeks to understand the structural rela.onship of

294 views • 26 slides
Biomechanics BIOEN 520 | ME 527 Session 7A Computa>onal

Biomechanics BIOEN 520 | ME 527 Session 7A Computa>onal

Musculoskeletal Biomechanics BIOEN 520 | ME 527 Session 7A Computa>onal Modeling Review: Session 5A, 5B and 6 Imaging in Biomechanics The Matrix

609 views • 43 slides
(Nega&ve) controls Morgane Thomas-Chollier Computa)onal systems

(Nega&ve) controls Morgane Thomas-Chollier Computa)onal systems

(Nega&ve) controls Morgane Thomas-Chollier Computa)onal systems biology - IBENS mthomas@biologie.ens.fr M2 Computa6onal analysis of cis-regulatory

403 views • 17 slides
7. Dynamics & Age Outline 7.1. Dynamics & Age 7.2. Temporal Information 7.3. Search in

7. Dynamics & Age Outline 7.1. Dynamics & Age 7.2. Temporal Information 7.3. Search in

7. Dynamics & Age Outline 7.1. Dynamics & Age 7.2. Temporal Information 7.3. Search in Web Archives 7.4. Historical Document Collections Advanced Topics in Information Retrieval / Dynamics & Age 2 7.1. Dynamics & Age The

989 views • 80 slides
Computa(onal Fuzzy Extractors Benjamin Fuller , Xianrui Meng, and

Computa(onal Fuzzy Extractors Benjamin Fuller , Xianrui Meng, and

Computa(onal Fuzzy Extractors Benjamin Fuller , Xianrui Meng, and Leonid Reyzin December 2, 2013 Key Derivation from Noisy Sources High-entropy sources Physically

645 views • 29 slides

More recommend