Bioinformatics platform options for Public Health Laboratories
Agenda • Introductions • Overview and background of bioinformatics • Small group sessions • On‐site server • Commercial platform • Web‐based platform • Discussion and re‐cap www.aphl.org
Introductions • Christin Hanigan, APHL • Kelly Oakeson, UT PHL • Joel Sevinsky, Thiagen, LLC • Kevin Libuit, VA DCLS • Logan Fink, CO PHL www.aphl.org
The Deep Impact of Next Generation Sequencing 100,000,000 Sanger Sequencing Next‐Generation Sequencing 10,000,000 Nucleotides per $1,000 1,000,000 100,000 10,000 1,000 Moore’s Law 100 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015 Adapted from NHGRI (https://www.genome.gov/sequencingcosts) www.aphl.org
Advanced Molecular Detection (AMD) 2011: “Bioinformatics Blue Ribbon Panel” 2014: Advanced Molecular Detection and Response to Infectious Disease Outbreaks (AMD) budget initiative approved by Congress • $30M/yr public health laboratory innovation program • Focus on transformational laboratory tech & scientific computing The AMD Program has five key objectives: 1. Improve pathogen detection and characterization 2. Enable new diagnostic methods to meet public health needs 3. Support genomic and bioinformatics needs in the US public health system 4. Implement enhanced, sustainable, integrated information systems 5. Develop tools for prediction, modeling and early recognition of emerging infectious threats www.aphl.org
Workforce Development and Bioinformatics Regional Resource support Training lead only • GA PHL • WY PHL • MI PHL Bioinformatics Resource lead only • CO PHL • FL BPHL • WI SLH Training and Bioinformatics resource • VA DCLS • MN PHL • MA PHL • WA PHL www.aphl.org
NGS Capacity in PHL (2013) www.aphl.org
NGS Capacity in PHL (2015) www.aphl.org
NGS Capacity in PHL (2016) www.aphl.org
NGS Capacity in PHL (2018) www.aphl.org
Bioinformatics platforms utilized by PHLs 45.00% 40.00% 35.00% 30.00% 25.00% 20.00% 15.00% 10.00% 5.00% 0.00% www.aphl.org
Bioinformatics resources accessed by PHLs 60.00% 50.00% 40.00% 30.00% 20.00% 10.00% 0.00% Access to Other staff Regional No access to Bioinformaticians Bioinformatics bioinformaticians trained to resource* bioinformaticians on staff fellow through external perform partnership bioinformatics analysis www.aphl.org
Pathogens PHLs are sequencing outside of Pulsenet 25.00% 20.00% 15.00% 10.00% 5.00% 0.00% www.aphl.org
NGS in PHL All 50 states have at least 1 sequencer in-house . Began as primarily foodborne enteric bacterial pathogens • Network-driven initiative • Surveillance and outbreak detection • Transitioning from PFGE to WGS since 2014 • Heavy reliance on federal partners for bioinformatics analysis Growing dependence on WGS data • PulseNet: Complete transition to WGS for national surveillance of major foodborne pathogens by January of 2019 Bioinformatics capacity and support continues to be one of the biggest challenges in the growth of NGS www.aphl.org
Agenda • Introductions • Overview and background of bioinformatics • Small group sessions • On‐site server • Commercial platform • Web‐based platform • Discussion and re‐cap www.aphl.org
Questions? Christin Hanigan Sr. Specialist, AMD Christin.Hanigan@aphl.org Office of Advanced Molecular Detection, CDC Greg Armstrong Tiki Barnes Duncan MacCannell oamd@cdc.gov www.aphl.org
www.aphl.org
www.aphl.org
ACAATTTGTGCATAACATGTGGACAGTTTTAATCACATGTGGGTAAATAGTTGTCCACATTTGCTTTTTT TGTCGAAAACCCTATCTCATATACAAACGACGTTTTTAGGTTTTAAAATACGTTTCGTATAAATATACAT TTTATATTTATTAGGTTGTACATTTGTTGCGCAACCTTATTCTTTTACCATCTTAGTAAAGGAGGGACAC CTTTGGAAAATATCTCTGATTTATGGAATAGTGCCTTAAAAGAATTAGAAAAAAAGGTAAGCAAGCCTAG TTATGAAACATGGTTAAAATCAACAACGGCTCATAACTTGAAGAAAGACGTATTAACGATTACAGCTCCA AATGAATTTGCTCGTGACTGGCTAGAATCTCATTACTCAGAACTTATTTCGGAAACACTATACGATTTAA Library Data Info. CAGGGGCAAAATTAGCAATTCGCTTTATTATTCCCCAAAGTCAATCGGAAGAGGACATTGATCTTCCTCC AGTTAAGCGGAATCCAGCACAAGATGATTCAGCTCATTTACCACAGAGCATGTTAAATCCAAAATATACA TTTGATACATTTGTTATCGGCTCTGGTAACCGTTTTGCCCATGCAGCTTCATTAGCTGTAGCCGAGGCGC CAGCTAAAGCGTATAATCCACTCTTTATTTATGGGGGAGTTGGGCTTGGAAAGACGCATTTAATGCACGC AATTGGTCATTATGTAATTGAACATAATCCAAATGCAAAAGTTGTATATTTATCATCAGAAAAATTCACG AATGAATTTATTAACTCTATTCGTGATAATAAAGCTGTTGATTTTCGTAATAAATATCGCAACGTAGATG Output: Information Bioinformatics Input: DNA/RNA NGS From Sequence Data Workflow: Workflow: Source: Hardware/software Genomic Platforms Specialized skillsets Chemistry Comparative Genomics Amplicon Algorithms/pipelines Identification Whole sample Perf. char. Pathogen databases High res Straintyping/Subtyping Labor/TaT Expertise Data analysis/interpret/ Cluster identification Host/vector/ Integration/visualization Molecular evolution pathogen/ Cost environment Genotypic characterization Virulence, AR, signatures Functional annotation … Diagnostic dev/validation Increasingly Universal Workflows A Moving Target Minor populations, quasispecies Working to establish standardized sequencing Rapidly evolving technology space. Changing Host/pathogen expression workflows for a wide range of pathogens. hardware and COTS/OSS capabilities. Lots of choice, but lack of consistent standards. BIG Metagenomics DATA. New workforce and skillset is Pathogen identification/discovery required. Culture‐independent diagnostics Security Microbial ecology/diversity Sample intake File hashes/versioning QA/QC Conversion Skills/proficiency Prep/staging Validated methods/databases Library prep Standards Reporting Extraction Process logging/audit Sequencing Many results from a single dataset. Faster and cheaper than serial tests. Pathogen‐ and application‐specific, standard and/or compliant assays www.aphl.org
Recommend
More recommend
